Incidental Mutation 'R8726:Kremen2'
ID662460
Institutional Source Beutler Lab
Gene Symbol Kremen2
Ensembl Gene ENSMUSG00000040680
Gene Namekringle containing transmembrane protein 2
Synonyms2900054E04Rik, Krm2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23741197-23745833 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23742746 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 262 (F262L)
Ref Sequence ENSEMBL: ENSMUSP00000046369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024702] [ENSMUST00000046525]
Predicted Effect probably benign
Transcript: ENSMUST00000024702
SMART Domains Protein: ENSMUSP00000024702
Gene: ENSMUSG00000023909

DomainStartEndE-ValueType
Pfam:HlyIII 43 254 1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046525
AA Change: F262L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046369
Gene: ENSMUSG00000040680
AA Change: F262L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
KR 33 120 2.44e-18 SMART
Pfam:WSC 123 204 1.3e-20 PFAM
CUB 218 325 8.04e-15 SMART
Blast:CUB 351 422 8e-6 BLAST
low complexity region 446 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Kremen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02327:Kremen2 APN 17 23743569 missense probably benign 0.11
R0057:Kremen2 UTSW 17 23743228 missense possibly damaging 0.94
R0369:Kremen2 UTSW 17 23742810 missense probably benign 0.02
R0835:Kremen2 UTSW 17 23742837 missense probably damaging 0.99
R0847:Kremen2 UTSW 17 23744660 missense probably damaging 1.00
R1733:Kremen2 UTSW 17 23743399 splice site probably null
R2056:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2057:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2058:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2173:Kremen2 UTSW 17 23742796 missense probably damaging 0.98
R5553:Kremen2 UTSW 17 23741802 unclassified probably benign
R5583:Kremen2 UTSW 17 23742255 missense probably benign 0.00
R6057:Kremen2 UTSW 17 23742705 missense probably benign 0.00
R6510:Kremen2 UTSW 17 23743655 missense possibly damaging 0.91
R7068:Kremen2 UTSW 17 23741885 missense possibly damaging 0.87
R7227:Kremen2 UTSW 17 23744599 nonsense probably null
R7382:Kremen2 UTSW 17 23743552 splice site probably null
R8113:Kremen2 UTSW 17 23743802 missense probably damaging 1.00
R8167:Kremen2 UTSW 17 23743340 missense probably damaging 1.00
R8328:Kremen2 UTSW 17 23742771 missense probably benign
R8544:Kremen2 UTSW 17 23742227 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCCTCTGGAGATGCTCTGC -3'
(R):5'- ACCTGCGCTGGAAAGAAAGC -3'

Sequencing Primer
(F):5'- GAGATGCTCTGCCCTCCACTG -3'
(R):5'- AAGCTGGCCTCTTGTTTCTTGAC -3'
Posted On2021-03-08