Incidental Mutation 'R8726:Tekt4'
ID 662461
Institutional Source Beutler Lab
Gene Symbol Tekt4
Ensembl Gene ENSMUSG00000024175
Gene Name tektin 4
Synonyms 1700010L19Rik
MMRRC Submission 068616-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8726 (G1)
Quality Score 224.009
Status Validated
Chromosome 17
Chromosomal Location 25673589-25695576 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25691033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 113 (W113L)
Ref Sequence ENSEMBL: ENSMUSP00000025002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025002]
AlphaFold Q149S1
Predicted Effect probably damaging
Transcript: ENSMUST00000025002
AA Change: W113L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025002
Gene: ENSMUSG00000024175
AA Change: W113L

DomainStartEndE-ValueType
Pfam:Tektin 56 438 6.2e-143 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased male fertility due to abnormal flagellum function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,789,207 (GRCm39) S331P possibly damaging Het
4930433I11Rik A G 7: 40,644,226 (GRCm39) M632V probably benign Het
9930111J21Rik2 A C 11: 48,910,507 (GRCm39) V642G probably damaging Het
Abcd4 A T 12: 84,651,171 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,525,462 (GRCm39) E363G probably damaging Het
Ank3 T A 10: 69,823,084 (GRCm39) H584Q Het
Ankrd11 A T 8: 123,620,765 (GRCm39) L1029Q possibly damaging Het
Anpep C T 7: 79,490,641 (GRCm39) V292I probably benign Het
Atmin G A 8: 117,681,525 (GRCm39) D175N possibly damaging Het
B4galt6 T C 18: 20,821,450 (GRCm39) I359M possibly damaging Het
Bicd2 A G 13: 49,532,905 (GRCm39) D497G probably damaging Het
Calcr C T 6: 3,707,489 (GRCm39) probably benign Het
Camkk2 G T 5: 122,882,002 (GRCm39) D418E probably benign Het
Cntn3 A T 6: 102,146,014 (GRCm39) Y942* probably null Het
Col8a1 C T 16: 57,449,138 (GRCm39) R124H probably damaging Het
Coro7 T C 16: 4,486,619 (GRCm39) T185A possibly damaging Het
Creb3 C T 4: 43,566,747 (GRCm39) P364S probably benign Het
Csf1r A T 18: 61,250,728 (GRCm39) T480S probably benign Het
Csnk1g1 T A 9: 65,909,553 (GRCm39) H223Q probably damaging Het
Ctns C T 11: 73,078,613 (GRCm39) V171M probably benign Het
Dhx15 A T 5: 52,311,568 (GRCm39) N637K probably benign Het
Eif4g1 T C 16: 20,494,232 (GRCm39) Y103H probably damaging Het
Eif4g2 C T 7: 110,676,629 (GRCm39) R295H probably damaging Het
Fat1 C T 8: 45,477,206 (GRCm39) P2084L probably benign Het
Fat4 A G 3: 39,064,647 (GRCm39) R4868G probably damaging Het
Fbxo31 A T 8: 122,282,014 (GRCm39) Y295* probably null Het
Fmn2 C A 1: 174,437,404 (GRCm39) T1125N possibly damaging Het
Foxi2 C A 7: 135,012,133 (GRCm39) P7Q probably damaging Het
Hmx1 C T 5: 35,549,100 (GRCm39) P131L probably damaging Het
Hrh2 T C 13: 54,368,171 (GRCm39) L49P probably damaging Het
Hycc2 T C 1: 58,585,285 (GRCm39) T171A possibly damaging Het
Igkv6-14 A G 6: 70,412,125 (GRCm39) V53A possibly damaging Het
Kcnb2 C A 1: 15,780,876 (GRCm39) Q583K probably benign Het
Kcns3 A G 12: 11,141,692 (GRCm39) S336P probably damaging Het
Kremen2 G T 17: 23,961,720 (GRCm39) F262L probably damaging Het
Krtap9-1 T A 11: 99,764,577 (GRCm39) C104* probably null Het
Ky A G 9: 102,405,102 (GRCm39) Y199C probably damaging Het
L1td1 T G 4: 98,622,215 (GRCm39) L259R probably damaging Het
Lrba A G 3: 86,261,062 (GRCm39) T1473A probably benign Het
Lrp6 A T 6: 134,484,624 (GRCm39) L333* probably null Het
Lrrc23 T C 6: 124,753,043 (GRCm39) N201S probably benign Het
Map4k4 C A 1: 40,043,142 (GRCm39) P666T possibly damaging Het
Matn1 T A 4: 130,679,514 (GRCm39) D389E probably damaging Het
Mdc1 G T 17: 36,158,475 (GRCm39) G285V probably benign Het
Mettl17 T C 14: 52,128,187 (GRCm39) probably null Het
Mknk1 A T 4: 115,730,506 (GRCm39) probably benign Het
Neurod1 A T 2: 79,284,430 (GRCm39) F318I possibly damaging Het
Nfya T C 17: 48,699,445 (GRCm39) T213A probably damaging Het
Nmrk1 C T 19: 18,616,902 (GRCm39) T17M probably damaging Het
Ntrk1 A C 3: 87,693,396 (GRCm39) D245E probably benign Het
Nup160 C A 2: 90,563,545 (GRCm39) H1370Q possibly damaging Het
Or11h6 A C 14: 50,880,703 (GRCm39) K316Q probably benign Het
Or5w8 T C 2: 87,688,161 (GRCm39) V214A probably benign Het
Or6x1 T A 9: 40,098,663 (GRCm39) V84E probably damaging Het
Parp4 G A 14: 56,866,556 (GRCm39) R1040H probably benign Het
Pdia4 C A 6: 47,785,200 (GRCm39) E56* probably null Het
Pdia5 A G 16: 35,269,784 (GRCm39) F175S probably damaging Het
Piezo2 C T 18: 63,242,956 (GRCm39) S621N probably benign Het
Pigw T C 11: 84,768,643 (GRCm39) T229A possibly damaging Het
Rasa3 T C 8: 13,626,381 (GRCm39) Y734C probably benign Het
Rfx7 T A 9: 72,500,505 (GRCm39) probably benign Het
Rims1 T C 1: 22,633,181 (GRCm39) D178G possibly damaging Het
Ros1 A G 10: 51,954,769 (GRCm39) V1853A possibly damaging Het
Rps7 A G 12: 28,681,714 (GRCm39) I139T probably benign Het
Sall3 T C 18: 81,029,708 (GRCm39) D15G possibly damaging Het
Scn1a A T 2: 66,133,983 (GRCm39) V137D probably benign Het
Slc23a3 G A 1: 75,106,173 (GRCm39) P349S probably benign Het
Slc35a5 C G 16: 44,964,021 (GRCm39) R404P probably damaging Het
Stard13 A T 5: 150,986,607 (GRCm39) M301K probably benign Het
Suclg2 A G 6: 95,632,489 (GRCm39) F60S probably damaging Het
Tecpr2 T A 12: 110,904,668 (GRCm39) F887L possibly damaging Het
Tep1 G A 14: 51,085,080 (GRCm39) S901F probably damaging Het
Tex11 C T X: 100,059,191 (GRCm39) V190I possibly damaging Het
Thbs1 T A 2: 117,949,957 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,040,295 (GRCm39) V425D probably damaging Het
Tpo A G 12: 30,105,137 (GRCm39) L911P possibly damaging Het
Ttn T C 2: 76,729,301 (GRCm39) Q5332R unknown Het
Wdr59 A T 8: 112,223,466 (GRCm39) D169E Het
Zfp799 C A 17: 33,039,166 (GRCm39) G367C probably damaging Het
Other mutations in Tekt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Tekt4 APN 17 25,695,358 (GRCm39) missense probably benign 0.31
IGL02657:Tekt4 APN 17 25,692,732 (GRCm39) missense possibly damaging 0.93
R0788:Tekt4 UTSW 17 25,691,021 (GRCm39) missense probably damaging 1.00
R1280:Tekt4 UTSW 17 25,690,861 (GRCm39) missense probably damaging 1.00
R1466:Tekt4 UTSW 17 25,691,048 (GRCm39) missense probably benign 0.29
R1466:Tekt4 UTSW 17 25,691,048 (GRCm39) missense probably benign 0.29
R1819:Tekt4 UTSW 17 25,692,785 (GRCm39) splice site probably null
R1902:Tekt4 UTSW 17 25,690,832 (GRCm39) missense possibly damaging 0.63
R2262:Tekt4 UTSW 17 25,695,485 (GRCm39) missense possibly damaging 0.76
R2263:Tekt4 UTSW 17 25,695,485 (GRCm39) missense possibly damaging 0.76
R4010:Tekt4 UTSW 17 25,695,460 (GRCm39) missense probably damaging 1.00
R4604:Tekt4 UTSW 17 25,690,749 (GRCm39) missense probably benign
R5085:Tekt4 UTSW 17 25,692,749 (GRCm39) missense probably damaging 0.99
R6187:Tekt4 UTSW 17 25,691,197 (GRCm39) missense probably damaging 1.00
R7102:Tekt4 UTSW 17 25,693,718 (GRCm39) missense probably damaging 0.99
R9178:Tekt4 UTSW 17 25,690,901 (GRCm39) missense possibly damaging 0.73
R9616:Tekt4 UTSW 17 25,692,782 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAAATACCTGAGGGACGAGTG -3'
(R):5'- ACTGGTTGCACCTTCAGTAGC -3'

Sequencing Primer
(F):5'- ACGAGTGGTTTCAGAACTCTTATGC -3'
(R):5'- TTCAGTAGCTCCACCTCCACATAG -3'
Posted On 2021-03-08