Incidental Mutation 'R8726:Nfya'
ID662464
Institutional Source Beutler Lab
Gene Symbol Nfya
Ensembl Gene ENSMUSG00000023994
Gene Namenuclear transcription factor-Y alpha
SynonymsSez10, Cbf-b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location48386885-48409906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48392417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000043909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046719] [ENSMUST00000078800] [ENSMUST00000159063] [ENSMUST00000159535] [ENSMUST00000160319] [ENSMUST00000161117] [ENSMUST00000161256] [ENSMUST00000162460]
Predicted Effect probably damaging
Transcript: ENSMUST00000046719
AA Change: T213A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043909
Gene: ENSMUSG00000023994
AA Change: T213A

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 205 223 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
CBF 260 321 3.92e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078800
AA Change: T212A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077853
Gene: ENSMUSG00000023994
AA Change: T212A

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 57 N/A INTRINSIC
low complexity region 98 166 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
CBF 259 320 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159063
AA Change: T178A
SMART Domains Protein: ENSMUSP00000124404
Gene: ENSMUSG00000023994
AA Change: T178A

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
CBF 225 286 3.92e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159237
AA Change: T73A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124115
Gene: ENSMUSG00000023994
AA Change: T73A

DomainStartEndE-ValueType
low complexity region 66 84 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
CBF 121 182 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159535
AA Change: T205A
SMART Domains Protein: ENSMUSP00000124501
Gene: ENSMUSG00000023994
AA Change: T205A

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
internal_repeat_1 57 82 3.82e-6 PROSPERO
internal_repeat_1 74 95 3.82e-6 PROSPERO
low complexity region 97 165 N/A INTRINSIC
low complexity region 197 215 N/A INTRINSIC
low complexity region 218 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160319
AA Change: T207A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124245
Gene: ENSMUSG00000023994
AA Change: T207A

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
low complexity region 220 234 N/A INTRINSIC
CBF 254 315 3.92e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161117
AA Change: T178A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124965
Gene: ENSMUSG00000023994
AA Change: T178A

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
internal_repeat_1 24 49 2.33e-5 PROSPERO
internal_repeat_1 41 62 2.33e-5 PROSPERO
low complexity region 64 132 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161256
AA Change: T77A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125034
Gene: ENSMUSG00000023994
AA Change: T77A

DomainStartEndE-ValueType
low complexity region 1 33 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
CBF 124 185 9.8e-38 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162460
AA Change: T184A
SMART Domains Protein: ENSMUSP00000123785
Gene: ENSMUSG00000023994
AA Change: T184A

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
CBF 231 292 3.92e-35 SMART
Meta Mutation Damage Score 0.1282 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus impairs development and results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Fmn2 C A 1: 174,609,838 T1125N possibly damaging Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Nfya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Nfya APN 17 48393255 unclassified probably benign
IGL02348:Nfya APN 17 48393276 nonsense probably null
IGL03220:Nfya APN 17 48400493 missense possibly damaging 0.66
IGL03274:Nfya APN 17 48391347 missense probably damaging 1.00
PIT4468001:Nfya UTSW 17 48395777 missense unknown
R0147:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0148:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0904:Nfya UTSW 17 48395787 nonsense probably null
R1484:Nfya UTSW 17 48393542 unclassified probably benign
R4105:Nfya UTSW 17 48392884 nonsense probably null
R4108:Nfya UTSW 17 48392884 nonsense probably null
R4109:Nfya UTSW 17 48392884 nonsense probably null
R4923:Nfya UTSW 17 48400535 utr 5 prime probably benign
R5411:Nfya UTSW 17 48392018 missense possibly damaging 0.83
R6299:Nfya UTSW 17 48392910 intron probably benign
R6846:Nfya UTSW 17 48395687 missense probably benign 0.04
R6967:Nfya UTSW 17 48392904 intron probably benign
R7027:Nfya UTSW 17 48389312 missense probably benign 0.00
R7634:Nfya UTSW 17 48392417 missense probably damaging 0.99
R8377:Nfya UTSW 17 48392045 missense possibly damaging 0.92
R8460:Nfya UTSW 17 48391946 missense possibly damaging 0.70
R8501:Nfya UTSW 17 48398989 missense unknown
R8935:Nfya UTSW 17 48393266 unclassified probably benign
R8950:Nfya UTSW 17 48393461 unclassified probably benign
Z1177:Nfya UTSW 17 48393513 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTTAAGGATGACGTTAGCG -3'
(R):5'- AGAAGGGACTAACTCTTTCCCC -3'

Sequencing Primer
(F):5'- CGTTAGCGTCAAATCCAGAAG -3'
(R):5'- AGGGACTAACTCTTTCCCCTTCTTTC -3'
Posted On2021-03-08