Incidental Mutation 'R8726:Piezo2'
ID 662467
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik
MMRRC Submission 068616-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8726 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 63143284-63520254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63242956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 621 (S621N)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046860
AA Change: S621N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: S621N

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047480
AA Change: S621N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: S621N

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000182233
AA Change: S389N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: S389N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183217
AA Change: S621N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: S621N

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,789,207 (GRCm39) S331P possibly damaging Het
4930433I11Rik A G 7: 40,644,226 (GRCm39) M632V probably benign Het
9930111J21Rik2 A C 11: 48,910,507 (GRCm39) V642G probably damaging Het
Abcd4 A T 12: 84,651,171 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,525,462 (GRCm39) E363G probably damaging Het
Ank3 T A 10: 69,823,084 (GRCm39) H584Q Het
Ankrd11 A T 8: 123,620,765 (GRCm39) L1029Q possibly damaging Het
Anpep C T 7: 79,490,641 (GRCm39) V292I probably benign Het
Atmin G A 8: 117,681,525 (GRCm39) D175N possibly damaging Het
B4galt6 T C 18: 20,821,450 (GRCm39) I359M possibly damaging Het
Bicd2 A G 13: 49,532,905 (GRCm39) D497G probably damaging Het
Calcr C T 6: 3,707,489 (GRCm39) probably benign Het
Camkk2 G T 5: 122,882,002 (GRCm39) D418E probably benign Het
Cntn3 A T 6: 102,146,014 (GRCm39) Y942* probably null Het
Col8a1 C T 16: 57,449,138 (GRCm39) R124H probably damaging Het
Coro7 T C 16: 4,486,619 (GRCm39) T185A possibly damaging Het
Creb3 C T 4: 43,566,747 (GRCm39) P364S probably benign Het
Csf1r A T 18: 61,250,728 (GRCm39) T480S probably benign Het
Csnk1g1 T A 9: 65,909,553 (GRCm39) H223Q probably damaging Het
Ctns C T 11: 73,078,613 (GRCm39) V171M probably benign Het
Dhx15 A T 5: 52,311,568 (GRCm39) N637K probably benign Het
Eif4g1 T C 16: 20,494,232 (GRCm39) Y103H probably damaging Het
Eif4g2 C T 7: 110,676,629 (GRCm39) R295H probably damaging Het
Fat1 C T 8: 45,477,206 (GRCm39) P2084L probably benign Het
Fat4 A G 3: 39,064,647 (GRCm39) R4868G probably damaging Het
Fbxo31 A T 8: 122,282,014 (GRCm39) Y295* probably null Het
Fmn2 C A 1: 174,437,404 (GRCm39) T1125N possibly damaging Het
Foxi2 C A 7: 135,012,133 (GRCm39) P7Q probably damaging Het
Hmx1 C T 5: 35,549,100 (GRCm39) P131L probably damaging Het
Hrh2 T C 13: 54,368,171 (GRCm39) L49P probably damaging Het
Hycc2 T C 1: 58,585,285 (GRCm39) T171A possibly damaging Het
Igkv6-14 A G 6: 70,412,125 (GRCm39) V53A possibly damaging Het
Kcnb2 C A 1: 15,780,876 (GRCm39) Q583K probably benign Het
Kcns3 A G 12: 11,141,692 (GRCm39) S336P probably damaging Het
Kremen2 G T 17: 23,961,720 (GRCm39) F262L probably damaging Het
Krtap9-1 T A 11: 99,764,577 (GRCm39) C104* probably null Het
Ky A G 9: 102,405,102 (GRCm39) Y199C probably damaging Het
L1td1 T G 4: 98,622,215 (GRCm39) L259R probably damaging Het
Lrba A G 3: 86,261,062 (GRCm39) T1473A probably benign Het
Lrp6 A T 6: 134,484,624 (GRCm39) L333* probably null Het
Lrrc23 T C 6: 124,753,043 (GRCm39) N201S probably benign Het
Map4k4 C A 1: 40,043,142 (GRCm39) P666T possibly damaging Het
Matn1 T A 4: 130,679,514 (GRCm39) D389E probably damaging Het
Mdc1 G T 17: 36,158,475 (GRCm39) G285V probably benign Het
Mettl17 T C 14: 52,128,187 (GRCm39) probably null Het
Mknk1 A T 4: 115,730,506 (GRCm39) probably benign Het
Neurod1 A T 2: 79,284,430 (GRCm39) F318I possibly damaging Het
Nfya T C 17: 48,699,445 (GRCm39) T213A probably damaging Het
Nmrk1 C T 19: 18,616,902 (GRCm39) T17M probably damaging Het
Ntrk1 A C 3: 87,693,396 (GRCm39) D245E probably benign Het
Nup160 C A 2: 90,563,545 (GRCm39) H1370Q possibly damaging Het
Or11h6 A C 14: 50,880,703 (GRCm39) K316Q probably benign Het
Or5w8 T C 2: 87,688,161 (GRCm39) V214A probably benign Het
Or6x1 T A 9: 40,098,663 (GRCm39) V84E probably damaging Het
Parp4 G A 14: 56,866,556 (GRCm39) R1040H probably benign Het
Pdia4 C A 6: 47,785,200 (GRCm39) E56* probably null Het
Pdia5 A G 16: 35,269,784 (GRCm39) F175S probably damaging Het
Pigw T C 11: 84,768,643 (GRCm39) T229A possibly damaging Het
Rasa3 T C 8: 13,626,381 (GRCm39) Y734C probably benign Het
Rfx7 T A 9: 72,500,505 (GRCm39) probably benign Het
Rims1 T C 1: 22,633,181 (GRCm39) D178G possibly damaging Het
Ros1 A G 10: 51,954,769 (GRCm39) V1853A possibly damaging Het
Rps7 A G 12: 28,681,714 (GRCm39) I139T probably benign Het
Sall3 T C 18: 81,029,708 (GRCm39) D15G possibly damaging Het
Scn1a A T 2: 66,133,983 (GRCm39) V137D probably benign Het
Slc23a3 G A 1: 75,106,173 (GRCm39) P349S probably benign Het
Slc35a5 C G 16: 44,964,021 (GRCm39) R404P probably damaging Het
Stard13 A T 5: 150,986,607 (GRCm39) M301K probably benign Het
Suclg2 A G 6: 95,632,489 (GRCm39) F60S probably damaging Het
Tecpr2 T A 12: 110,904,668 (GRCm39) F887L possibly damaging Het
Tekt4 G T 17: 25,691,033 (GRCm39) W113L probably damaging Het
Tep1 G A 14: 51,085,080 (GRCm39) S901F probably damaging Het
Tex11 C T X: 100,059,191 (GRCm39) V190I possibly damaging Het
Thbs1 T A 2: 117,949,957 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,040,295 (GRCm39) V425D probably damaging Het
Tpo A G 12: 30,105,137 (GRCm39) L911P possibly damaging Het
Ttn T C 2: 76,729,301 (GRCm39) Q5332R unknown Het
Wdr59 A T 8: 112,223,466 (GRCm39) D169E Het
Zfp799 C A 17: 33,039,166 (GRCm39) G367C probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,250,770 (GRCm39) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,155,531 (GRCm39) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,203,101 (GRCm39) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,257,685 (GRCm39) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,163,463 (GRCm39) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,315,904 (GRCm39) splice site probably benign
IGL01674:Piezo2 APN 18 63,160,630 (GRCm39) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,216,241 (GRCm39) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,175,859 (GRCm39) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,225,915 (GRCm39) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,153,705 (GRCm39) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,279,915 (GRCm39) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,205,933 (GRCm39) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,165,995 (GRCm39) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,157,546 (GRCm39) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,207,730 (GRCm39) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,197,856 (GRCm39) splice site probably benign
IGL03011:Piezo2 APN 18 63,257,731 (GRCm39) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,203,146 (GRCm39) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,163,343 (GRCm39) splice site probably null
IGL03129:Piezo2 APN 18 63,248,043 (GRCm39) missense probably benign
IGL03143:Piezo2 APN 18 63,241,147 (GRCm39) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,144,669 (GRCm39) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,257,677 (GRCm39) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,186,133 (GRCm39) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,174,791 (GRCm39) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,144,609 (GRCm39) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,154,379 (GRCm39) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,160,775 (GRCm39) missense probably damaging 1.00
Piccolo UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
sopranino UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
woodwind UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,519,271 (GRCm39) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,157,540 (GRCm39) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,235,155 (GRCm39) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,157,562 (GRCm39) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,162,132 (GRCm39) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,235,245 (GRCm39) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,157,522 (GRCm39) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,160,615 (GRCm39) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,155,552 (GRCm39) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,155,497 (GRCm39) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,152,329 (GRCm39) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,174,794 (GRCm39) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,216,306 (GRCm39) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,148,873 (GRCm39) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,219,824 (GRCm39) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,154,325 (GRCm39) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,216,202 (GRCm39) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,277,990 (GRCm39) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,215,986 (GRCm39) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,250,743 (GRCm39) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,154,244 (GRCm39) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,239,355 (GRCm39) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,241,158 (GRCm39) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,165,911 (GRCm39) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,152,415 (GRCm39) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,247,031 (GRCm39) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,211,911 (GRCm39) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,211,852 (GRCm39) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,277,997 (GRCm39) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,192,815 (GRCm39) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,252,006 (GRCm39) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,214,805 (GRCm39) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,250,791 (GRCm39) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,247,112 (GRCm39) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,239,345 (GRCm39) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,155,596 (GRCm39) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,378,695 (GRCm39) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,186,106 (GRCm39) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,279,914 (GRCm39) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,157,506 (GRCm39) nonsense probably null
R3016:Piezo2 UTSW 18 63,175,903 (GRCm39) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,214,864 (GRCm39) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,183,675 (GRCm39) missense probably benign
R4181:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,217,911 (GRCm39) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,235,170 (GRCm39) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,247,134 (GRCm39) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,205,951 (GRCm39) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,219,699 (GRCm39) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,203,034 (GRCm39) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,278,025 (GRCm39) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,211,862 (GRCm39) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,290,333 (GRCm39) missense probably benign
R4961:Piezo2 UTSW 18 63,186,032 (GRCm39) splice site probably null
R4968:Piezo2 UTSW 18 63,278,042 (GRCm39) nonsense probably null
R4973:Piezo2 UTSW 18 63,207,751 (GRCm39) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,216,184 (GRCm39) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,157,607 (GRCm39) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,207,691 (GRCm39) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,163,480 (GRCm39) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,166,000 (GRCm39) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,197,802 (GRCm39) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,217,811 (GRCm39) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,278,176 (GRCm39) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,160,935 (GRCm39) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,144,792 (GRCm39) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,278,162 (GRCm39) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,250,768 (GRCm39) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,250,767 (GRCm39) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,279,927 (GRCm39) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,160,972 (GRCm39) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,247,005 (GRCm39) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6073:Piezo2 UTSW 18 63,145,716 (GRCm39) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,290,281 (GRCm39) nonsense probably null
R6255:Piezo2 UTSW 18 63,254,341 (GRCm39) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,250,749 (GRCm39) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,239,364 (GRCm39) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,219,678 (GRCm39) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,174,734 (GRCm39) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,239,342 (GRCm39) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,154,399 (GRCm39) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,154,333 (GRCm39) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,165,960 (GRCm39) nonsense probably null
R6855:Piezo2 UTSW 18 63,223,950 (GRCm39) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,166,057 (GRCm39) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,216,032 (GRCm39) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,278,181 (GRCm39) nonsense probably null
R7162:Piezo2 UTSW 18 63,257,780 (GRCm39) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,241,101 (GRCm39) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,150,590 (GRCm39) splice site probably null
R7395:Piezo2 UTSW 18 63,160,634 (GRCm39) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,157,543 (GRCm39) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,145,794 (GRCm39) missense probably benign
R7517:Piezo2 UTSW 18 63,215,996 (GRCm39) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,186,081 (GRCm39) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,175,610 (GRCm39) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,246,947 (GRCm39) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,216,016 (GRCm39) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,216,271 (GRCm39) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,175,882 (GRCm39) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,163,537 (GRCm39) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,208,801 (GRCm39) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,145,857 (GRCm39) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,217,759 (GRCm39) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,178,611 (GRCm39) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,279,873 (GRCm39) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,225,971 (GRCm39) nonsense probably null
R8708:Piezo2 UTSW 18 63,226,086 (GRCm39) missense probably damaging 1.00
R8727:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8810:Piezo2 UTSW 18 63,248,034 (GRCm39) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,248,096 (GRCm39) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,225,902 (GRCm39) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,178,550 (GRCm39) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,250,815 (GRCm39) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,290,302 (GRCm39) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,154,372 (GRCm39) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,208,868 (GRCm39) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,157,637 (GRCm39) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,162,156 (GRCm39) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,235,236 (GRCm39) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,519,347 (GRCm39) start gained probably benign
R9608:Piezo2 UTSW 18 63,280,016 (GRCm39) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,248,108 (GRCm39) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,197,767 (GRCm39) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,160,657 (GRCm39) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,183,681 (GRCm39) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,150,648 (GRCm39) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,203,065 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGTTGTCCTTCATTGGGAATAAC -3'
(R):5'- GTGCCTTCACAACTATGGAGTAG -3'

Sequencing Primer
(F):5'- TACCGTCTATCTGTAGAGGCAAG -3'
(R):5'- TCACAACTATGGAGTAGAAAGAGCTC -3'
Posted On 2021-03-08