Incidental Mutation 'R8727:Nbn'
ID 662485
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Name nibrin
Synonyms Nbs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8727 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 15957925-15992589 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15963911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 104 (S104N)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
AlphaFold Q9R207
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: S104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: S104N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149069
AA Change: S104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: S104N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,273,756 T1770A unknown Het
A630089N07Rik C T 16: 98,066,451 A104T probably damaging Het
Abhd18 T A 3: 40,930,192 L222Q probably damaging Het
Adam30 C T 3: 98,163,032 T727M possibly damaging Het
Adh6b A T 3: 138,352,968 Q137L probably damaging Het
Alpl C T 4: 137,747,816 V269I probably benign Het
Ang2 C T 14: 51,195,539 G129S probably benign Het
Atp6v0a1 A T 11: 101,029,189 H216L possibly damaging Het
BC030500 C T 8: 58,913,015 T61I unknown Het
Brpf1 T G 6: 113,316,530 L520R probably damaging Het
Btbd10 A G 7: 113,328,419 I243T possibly damaging Het
Bub1 C A 2: 127,804,219 C947F probably damaging Het
C4b T C 17: 34,734,485 E1008G probably damaging Het
Ccdc40 A G 11: 119,264,497 T1188A probably benign Het
Cnn1 G T 9: 22,099,261 probably benign Het
Colgalt2 T C 1: 152,484,911 M233T probably damaging Het
Cox15 A T 19: 43,746,742 C195* probably null Het
Cped1 A T 6: 22,059,942 R202S possibly damaging Het
Dact2 A T 17: 14,196,884 C351* probably null Het
Dbnl A G 11: 5,788,582 N8S probably benign Het
Depdc1a T A 3: 159,522,719 N369K probably benign Het
Dnah2 A T 11: 69,524,179 L243Q probably damaging Het
Dscaml1 T A 9: 45,430,461 Y57N probably benign Het
Eif2b3 A G 4: 117,070,747 T388A probably benign Het
Eif4h A C 5: 134,625,539 probably null Het
Elf1 C T 14: 79,573,227 Q288* probably null Het
Fbxl5 A T 5: 43,751,020 probably benign Het
Fgl2 C T 5: 21,375,679 R340* probably null Het
Fut4 T C 9: 14,750,786 D404G probably damaging Het
Glmn G A 5: 107,570,286 P255L probably benign Het
Gm14322 C T 2: 177,769,688 T97I probably benign Het
Gm44511 C A 6: 128,821,034 C32F probably damaging Het
Gm5478 A G 15: 101,645,436 F247S probably damaging Het
Gm7534 T C 4: 134,202,839 K52E probably benign Het
Golgb1 T A 16: 36,919,201 M2675K probably damaging Het
Hectd1 T C 12: 51,802,217 D368G possibly damaging Het
Hnrnpul2 A G 19: 8,820,700 N140S probably benign Het
Htr4 A T 18: 62,428,138 I157L probably damaging Het
Igf2bp3 G T 6: 49,109,075 probably benign Het
Kcnma1 T G 14: 23,386,264 M790L probably benign Het
Kcnv1 G A 15: 45,114,603 S13L unknown Het
Kctd20 C T 17: 28,965,051 R312* probably null Het
Kdm3b T A 18: 34,827,382 I1340N probably damaging Het
Kdm6b A G 11: 69,402,093 F1286L unknown Het
Knl1 T A 2: 119,069,043 F408L probably benign Het
Lypd5 G T 7: 24,353,676 G253W probably damaging Het
Mea1 A G 17: 46,681,688 T21A probably benign Het
Metrnl A G 11: 121,716,016 E299G possibly damaging Het
Mindy4 T A 6: 55,279,070 probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nxpe2 A T 9: 48,326,773 F61I probably benign Het
Olfr786 T C 10: 129,437,465 Y218H probably benign Het
Olfr814 T A 10: 129,874,223 D178V probably damaging Het
Pcdhb20 C T 18: 37,505,384 A321V probably damaging Het
Pgr C A 9: 8,901,543 P359Q probably damaging Het
Pi4k2b G A 5: 52,750,689 V157I probably benign Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Plekhm1 A C 11: 103,367,618 F1031L probably damaging Het
Pltp A G 2: 164,854,381 S124P probably damaging Het
Polr3gl T A 3: 96,579,838 E177V probably benign Het
Pstk G T 7: 131,371,295 R41L possibly damaging Het
Ptprk C A 10: 28,566,545 probably benign Het
Rasgrp1 T C 2: 117,288,677 E493G probably benign Het
Rtn3 A G 19: 7,457,361 L422P probably benign Het
Rusc2 C T 4: 43,401,351 probably benign Het
Sbno2 A G 10: 80,075,256 F6S probably benign Het
Sh2d4a A G 8: 68,346,043 Y348C probably damaging Het
Sh3rf3 A G 10: 59,104,170 probably null Het
Sipa1l2 T C 8: 125,450,386 E1163G probably benign Het
Strip1 G C 3: 107,614,648 A738G probably damaging Het
Tdrkh C T 3: 94,425,992 R255C probably benign Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Tln1 A T 4: 43,555,911 M101K possibly damaging Het
Trav6-2 A C 14: 52,667,571 probably benign Het
Tspan11 A T 6: 127,923,711 I82F possibly damaging Het
Ttn T C 2: 76,948,976 K1233E unknown Het
U2af2 T A 7: 5,067,433 probably benign Het
Usp29 A T 7: 6,962,918 S587C probably damaging Het
Vmn1r235 A T 17: 21,261,794 Q127L probably damaging Het
Vmn1r65 C A 7: 6,008,504 A244S probably damaging Het
Vmn2r18 A G 5: 151,584,997 S221P probably damaging Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
nebish UTSW 4 15965132 critical splice acceptor site probably null
zenobia UTSW 4 15969391 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.00
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 splice site probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
R7937:Nbn UTSW 4 15958080 missense probably damaging 0.99
R8110:Nbn UTSW 4 15981588 missense probably benign 0.02
R8317:Nbn UTSW 4 15970893 missense probably damaging 0.96
R8327:Nbn UTSW 4 15981470 missense probably benign 0.00
R8725:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8747:Nbn UTSW 4 15981555 missense probably damaging 0.96
R8909:Nbn UTSW 4 15970833 missense probably damaging 1.00
R8973:Nbn UTSW 4 15986585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCCACTTCCCCAGAAAGTTAG -3'
(R):5'- GACAATGTAACCAATGAGGACC -3'

Sequencing Primer
(F):5'- AGTAACTTGTGAGATCTACCCTG -3'
(R):5'- CCAAACAAGCTGAGTTCCCTGTTAC -3'
Posted On 2021-03-08