Incidental Mutation 'R8727:Or6c70'
ID 662518
Institutional Source Beutler Lab
Gene Symbol Or6c70
Ensembl Gene ENSMUSG00000059134
Gene Name olfactory receptor family 6 subfamily C member 70
Synonyms MOR113-8, MOR113-5, Olfr814, GA_x6K02T2PULF-11553313-11552381
MMRRC Submission 068575-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8727 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129709692-129710624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129710092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 178 (D178V)
Ref Sequence ENSEMBL: ENSMUSP00000150716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
AlphaFold Q7TRH4
Predicted Effect probably damaging
Transcript: ENSMUST00000081367
AA Change: D178V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: D178V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213742
AA Change: D178V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216966
AA Change: D178V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik C T 16: 97,867,651 (GRCm39) A104T probably damaging Het
Abhd18 T A 3: 40,884,627 (GRCm39) L222Q probably damaging Het
Adam30 C T 3: 98,070,348 (GRCm39) T727M possibly damaging Het
Adh6b A T 3: 138,058,729 (GRCm39) Q137L probably damaging Het
Alpl C T 4: 137,475,127 (GRCm39) V269I probably benign Het
Ang2 C T 14: 51,432,996 (GRCm39) G129S probably benign Het
Atp6v0a1 A T 11: 100,920,015 (GRCm39) H216L possibly damaging Het
BC030500 C T 8: 59,366,049 (GRCm39) T61I unknown Het
Brpf1 T G 6: 113,293,491 (GRCm39) L520R probably damaging Het
Btbd10 A G 7: 112,927,626 (GRCm39) I243T possibly damaging Het
Bub1 C A 2: 127,646,139 (GRCm39) C947F probably damaging Het
C4b T C 17: 34,953,459 (GRCm39) E1008G probably damaging Het
Ccdc40 A G 11: 119,155,323 (GRCm39) T1188A probably benign Het
Cdcp3 A G 7: 130,875,485 (GRCm39) T1770A unknown Het
Cnn1 G T 9: 22,010,557 (GRCm39) probably benign Het
Colgalt2 T C 1: 152,360,662 (GRCm39) M233T probably damaging Het
Cox15 A T 19: 43,735,181 (GRCm39) C195* probably null Het
Cped1 A T 6: 22,059,941 (GRCm39) R202S possibly damaging Het
Dact2 A T 17: 14,417,146 (GRCm39) C351* probably null Het
Dbnl A G 11: 5,738,582 (GRCm39) N8S probably benign Het
Depdc1a T A 3: 159,228,356 (GRCm39) N369K probably benign Het
Dnah2 A T 11: 69,415,005 (GRCm39) L243Q probably damaging Het
Dscaml1 T A 9: 45,341,759 (GRCm39) Y57N probably benign Het
Eif2b3 A G 4: 116,927,944 (GRCm39) T388A probably benign Het
Eif4h A C 5: 134,654,393 (GRCm39) probably null Het
Elf1 C T 14: 79,810,667 (GRCm39) Q288* probably null Het
Fbxl5 A T 5: 43,908,362 (GRCm39) probably benign Het
Fgl2 C T 5: 21,580,677 (GRCm39) R340* probably null Het
Fut4 T C 9: 14,662,082 (GRCm39) D404G probably damaging Het
Glmn G A 5: 107,718,152 (GRCm39) P255L probably benign Het
Gm14322 C T 2: 177,411,481 (GRCm39) T97I probably benign Het
Gm44511 C A 6: 128,797,997 (GRCm39) C32F probably damaging Het
Gm5478 A G 15: 101,553,871 (GRCm39) F247S probably damaging Het
Golgb1 T A 16: 36,739,563 (GRCm39) M2675K probably damaging Het
Hectd1 T C 12: 51,849,000 (GRCm39) D368G possibly damaging Het
Hnrnpul2 A G 19: 8,798,064 (GRCm39) N140S probably benign Het
Htr4 A T 18: 62,561,209 (GRCm39) I157L probably damaging Het
Igf2bp3 G T 6: 49,086,009 (GRCm39) probably benign Het
Kcnma1 T G 14: 23,436,332 (GRCm39) M790L probably benign Het
Kcnv1 G A 15: 44,977,999 (GRCm39) S13L unknown Het
Kctd20 C T 17: 29,184,025 (GRCm39) R312* probably null Het
Kdm3b T A 18: 34,960,435 (GRCm39) I1340N probably damaging Het
Kdm6b A G 11: 69,292,919 (GRCm39) F1286L unknown Het
Knl1 T A 2: 118,899,524 (GRCm39) F408L probably benign Het
Lypd5 G T 7: 24,053,101 (GRCm39) G253W probably damaging Het
Mea1 A G 17: 46,992,614 (GRCm39) T21A probably benign Het
Metrnl A G 11: 121,606,842 (GRCm39) E299G possibly damaging Het
Mindy4 T A 6: 55,256,055 (GRCm39) probably benign Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nxpe2 A T 9: 48,238,073 (GRCm39) F61I probably benign Het
Or6c1b T C 10: 129,273,334 (GRCm39) Y218H probably benign Het
Pcdhb20 C T 18: 37,638,437 (GRCm39) A321V probably damaging Het
Pgr C A 9: 8,901,544 (GRCm39) P359Q probably damaging Het
Pi4k2b G A 5: 52,908,031 (GRCm39) V157I probably benign Het
Piezo2 C T 18: 63,242,956 (GRCm39) S621N probably benign Het
Plekhm1 A C 11: 103,258,444 (GRCm39) F1031L probably damaging Het
Pltp A G 2: 164,696,301 (GRCm39) S124P probably damaging Het
Polr3gl T A 3: 96,487,154 (GRCm39) E177V probably benign Het
Pstk G T 7: 130,973,024 (GRCm39) R41L possibly damaging Het
Ptprk C A 10: 28,442,541 (GRCm39) probably benign Het
Rasgrp1 T C 2: 117,119,158 (GRCm39) E493G probably benign Het
Rtn3 A G 19: 7,434,726 (GRCm39) L422P probably benign Het
Rusc2 C T 4: 43,401,351 (GRCm39) probably benign Het
Sbno2 A G 10: 79,911,090 (GRCm39) F6S probably benign Het
Sh2d4a A G 8: 68,798,695 (GRCm39) Y348C probably damaging Het
Sh3rf3 A G 10: 58,939,992 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,177,125 (GRCm39) E1163G probably benign Het
Strip1 G C 3: 107,521,964 (GRCm39) A738G probably damaging Het
Tdrkh C T 3: 94,333,299 (GRCm39) R255C probably benign Het
Tex11 C T X: 100,059,191 (GRCm39) V190I possibly damaging Het
Tln1 A T 4: 43,555,911 (GRCm39) M101K possibly damaging Het
Trav6-2 A C 14: 52,905,028 (GRCm39) probably benign Het
Tspan11 A T 6: 127,900,674 (GRCm39) I82F possibly damaging Het
Ttn T C 2: 76,779,320 (GRCm39) K1233E unknown Het
U2af2 T A 7: 5,070,432 (GRCm39) probably benign Het
Usp29 A T 7: 6,965,917 (GRCm39) S587C probably damaging Het
Vmn1r235 A T 17: 21,482,056 (GRCm39) Q127L probably damaging Het
Vmn1r65 C A 7: 6,011,503 (GRCm39) A244S probably damaging Het
Vmn2r18 A G 5: 151,508,462 (GRCm39) S221P probably damaging Het
Zfp229 T C 17: 21,964,828 (GRCm39) S353P probably damaging Het
Zpld2 T C 4: 133,930,150 (GRCm39) K52E probably benign Het
Other mutations in Or6c70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Or6c70 APN 10 129,709,900 (GRCm39) missense probably damaging 1.00
IGL02045:Or6c70 APN 10 129,710,091 (GRCm39) missense probably benign 0.22
IGL02301:Or6c70 APN 10 129,709,948 (GRCm39) missense probably damaging 0.99
R0277:Or6c70 UTSW 10 129,709,936 (GRCm39) missense probably damaging 0.99
R0281:Or6c70 UTSW 10 129,710,415 (GRCm39) missense possibly damaging 0.88
R0323:Or6c70 UTSW 10 129,709,936 (GRCm39) missense probably damaging 0.99
R0394:Or6c70 UTSW 10 129,709,811 (GRCm39) missense probably benign 0.29
R0546:Or6c70 UTSW 10 129,710,407 (GRCm39) missense possibly damaging 0.94
R3813:Or6c70 UTSW 10 129,709,855 (GRCm39) missense probably damaging 1.00
R4086:Or6c70 UTSW 10 129,710,167 (GRCm39) missense possibly damaging 0.49
R4415:Or6c70 UTSW 10 129,709,826 (GRCm39) missense probably benign 0.00
R4416:Or6c70 UTSW 10 129,709,826 (GRCm39) missense probably benign 0.00
R4453:Or6c70 UTSW 10 129,710,530 (GRCm39) missense probably null 0.30
R5194:Or6c70 UTSW 10 129,709,967 (GRCm39) missense probably benign 0.00
R5306:Or6c70 UTSW 10 129,709,810 (GRCm39) missense probably damaging 0.97
R5362:Or6c70 UTSW 10 129,710,422 (GRCm39) missense probably damaging 1.00
R5609:Or6c70 UTSW 10 129,710,607 (GRCm39) missense probably benign 0.01
R5987:Or6c70 UTSW 10 129,710,390 (GRCm39) missense probably damaging 0.98
R6240:Or6c70 UTSW 10 129,710,546 (GRCm39) missense probably benign
R6896:Or6c70 UTSW 10 129,710,623 (GRCm39) start codon destroyed probably null 0.98
R7432:Or6c70 UTSW 10 129,709,719 (GRCm39) missense probably benign
R7489:Or6c70 UTSW 10 129,710,551 (GRCm39) missense probably damaging 1.00
R7652:Or6c70 UTSW 10 129,710,346 (GRCm39) missense probably damaging 0.99
R8316:Or6c70 UTSW 10 129,709,891 (GRCm39) missense probably damaging 1.00
R8725:Or6c70 UTSW 10 129,710,092 (GRCm39) missense probably damaging 1.00
R9089:Or6c70 UTSW 10 129,710,488 (GRCm39) missense probably damaging 1.00
R9538:Or6c70 UTSW 10 129,709,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAACTCCCATAAGTAAGGG -3'
(R):5'- GACCGCTATATTGCCATCTGC -3'

Sequencing Primer
(F):5'- CAACAATCATGTGAGAAGAACAAGTG -3'
(R):5'- CTGCAAACCCTTGCACTA -3'
Posted On 2021-03-08