Incidental Mutation 'R8728:Lmnb2'
ID 662587
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8728 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 80905079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219896]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000057623
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105332
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179022
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,312 T514A probably benign Het
Adam2 A G 14: 66,057,637 L253P probably damaging Het
Adamts20 C T 15: 94,331,400 G946D probably benign Het
Afdn A G 17: 13,898,945 R1648G probably damaging Het
Ak9 G A 10: 41,406,963 A1242T Het
Anxa9 T C 3: 95,302,668 K127E probably damaging Het
Atp6v0a2 T C 5: 124,719,088 S739P probably benign Het
Bloc1s6 A T 2: 122,746,106 M122L possibly damaging Het
Bms1 A G 6: 118,392,370 I990T possibly damaging Het
Cdk14 G A 5: 5,420,117 silent Het
Celsr3 T C 9: 108,846,741 L2899S probably benign Het
Ces1b A T 8: 93,071,948 D203E probably benign Het
Cnnm1 A G 19: 43,484,926 N753S probably benign Het
Col19a1 C T 1: 24,326,032 G501R probably damaging Het
Cym A G 3: 107,218,675 F91L possibly damaging Het
Cyp2c67 T G 19: 39,626,161 R307S probably damaging Het
Cyp3a59 G A 5: 146,098,312 probably null Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dagla G A 19: 10,248,407 R798C probably damaging Het
Dcaf1 C T 9: 106,846,806 R478C possibly damaging Het
Dcbld1 T C 10: 52,233,833 L28P probably benign Het
Ddr2 T C 1: 170,001,983 D234G possibly damaging Het
Fam83a T A 15: 58,009,666 M297K possibly damaging Het
Galnt18 T A 7: 111,520,036 D426V probably damaging Het
Gm10093 A G 17: 78,492,903 K441R probably benign Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 T C 5: 105,290,927 I32V probably benign Het
Gm9944 T C 4: 144,453,031 Y96C unknown Het
Impdh2 C T 9: 108,560,363 probably benign Het
Iws1 G A 18: 32,083,281 R358Q probably damaging Het
Kctd18 G T 1: 57,963,130 D179E probably damaging Het
Krt13 T G 11: 100,121,492 S2R probably null Het
Krt78 A T 15: 101,947,790 S529T probably benign Het
Krtap4-7 C G 11: 99,643,962 C25S unknown Het
Lama1 T C 17: 67,818,668 I2940T Het
Lrrc27 A T 7: 139,242,639 E482V probably damaging Het
Lrrc72 G A 12: 36,208,657 T67M probably benign Het
Malrd1 T A 2: 15,696,942 C789* probably null Het
Mei1 T G 15: 82,081,981 V268G Het
Mical3 C A 6: 120,973,553 A966S probably damaging Het
Mmp10 C T 9: 7,502,479 P29L probably benign Het
Mroh2b T C 15: 4,905,640 F186L probably damaging Het
Muc4 A T 16: 32,754,952 T1609S unknown Het
Myrfl A T 10: 116,798,640 C616* probably null Het
Ncor1 C T 11: 62,330,859 A946T probably benign Het
Olfr122 C A 17: 37,771,751 L33M probably damaging Het
Olfr330 T C 11: 58,529,201 T262A probably benign Het
Pbp2 T C 6: 135,310,106 Y81C probably benign Het
Plekhh1 C A 12: 79,069,088 Q802K possibly damaging Het
Pnldc1 A T 17: 12,897,278 F279Y probably damaging Het
Psmb5 A T 14: 54,617,804 L63Q probably damaging Het
Rasa3 C T 8: 13,586,873 probably null Het
Rbm4b G A 19: 4,762,191 M209I probably benign Het
Rnf38 A G 4: 44,131,615 S421P probably benign Het
Sema5a T C 15: 32,562,557 V238A probably damaging Het
Sesn1 G T 10: 41,903,775 G402W probably damaging Het
Six4 A G 12: 73,112,406 V260A probably benign Het
Srrm2 G A 17: 23,819,857 R1825Q unknown Het
Stat1 G A 1: 52,139,194 W262* probably null Het
Tcf20 A T 15: 82,854,957 D764E probably damaging Het
Tgm2 T C 2: 158,120,145 N585D probably benign Het
Tmf1 A T 6: 97,156,860 L1039H probably damaging Het
Trak2 A G 1: 58,935,775 V86A probably benign Het
Ttc39b A G 4: 83,253,010 I202T probably damaging Het
Uhrf1bp1l A T 10: 89,782,720 M274L probably benign Het
Vmn1r30 A G 6: 58,435,475 F124S probably benign Het
Vwa7 T A 17: 35,017,157 F29Y probably damaging Het
Wdr64 A T 1: 175,731,513 M281L probably benign Het
Zfand2a C T 5: 139,481,998 V40M possibly damaging Het
Zfp865 G C 7: 5,031,820 A935P probably damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80905148 missense probably damaging 0.97
R9032:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
R9063:Lmnb2 UTSW 10 80906171 missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCCTAAAAGCTGGTAGC -3'
(R):5'- GCACCTAGAGATAAAACCTGGC -3'

Sequencing Primer
(F):5'- GTCATTCTGGTCCGAGAG -3'
(R):5'- ACCAGTCTTATCCCCTCATAGGAG -3'
Posted On 2021-03-08