Incidental Mutation 'R8728:Tcf20'
ID 662603
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock # R8728 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 82808436-82987872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82854957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 764 (D764E)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: D764E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: D764E

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: D764E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: D764E

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,312 T514A probably benign Het
Adam2 A G 14: 66,057,637 L253P probably damaging Het
Adamts20 C T 15: 94,331,400 G946D probably benign Het
Afdn A G 17: 13,898,945 R1648G probably damaging Het
Ak9 G A 10: 41,406,963 A1242T Het
Anxa9 T C 3: 95,302,668 K127E probably damaging Het
Atp6v0a2 T C 5: 124,719,088 S739P probably benign Het
Bloc1s6 A T 2: 122,746,106 M122L possibly damaging Het
Bms1 A G 6: 118,392,370 I990T possibly damaging Het
Cdk14 G A 5: 5,420,117 silent Het
Celsr3 T C 9: 108,846,741 L2899S probably benign Het
Ces1b A T 8: 93,071,948 D203E probably benign Het
Cnnm1 A G 19: 43,484,926 N753S probably benign Het
Col19a1 C T 1: 24,326,032 G501R probably damaging Het
Cym A G 3: 107,218,675 F91L possibly damaging Het
Cyp2c67 T G 19: 39,626,161 R307S probably damaging Het
Cyp3a59 G A 5: 146,098,312 probably null Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dagla G A 19: 10,248,407 R798C probably damaging Het
Dcaf1 C T 9: 106,846,806 R478C possibly damaging Het
Dcbld1 T C 10: 52,233,833 L28P probably benign Het
Ddr2 T C 1: 170,001,983 D234G possibly damaging Het
Fam83a T A 15: 58,009,666 M297K possibly damaging Het
Galnt18 T A 7: 111,520,036 D426V probably damaging Het
Gm10093 A G 17: 78,492,903 K441R probably benign Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 T C 5: 105,290,927 I32V probably benign Het
Gm9944 T C 4: 144,453,031 Y96C unknown Het
Impdh2 C T 9: 108,560,363 probably benign Het
Iws1 G A 18: 32,083,281 R358Q probably damaging Het
Kctd18 G T 1: 57,963,130 D179E probably damaging Het
Krt13 T G 11: 100,121,492 S2R probably null Het
Krt78 A T 15: 101,947,790 S529T probably benign Het
Krtap4-7 C G 11: 99,643,962 C25S unknown Het
Lama1 T C 17: 67,818,668 I2940T Het
Lmnb2 A G 10: 80,905,079 probably null Het
Lrrc27 A T 7: 139,242,639 E482V probably damaging Het
Lrrc72 G A 12: 36,208,657 T67M probably benign Het
Malrd1 T A 2: 15,696,942 C789* probably null Het
Mei1 T G 15: 82,081,981 V268G Het
Mical3 C A 6: 120,973,553 A966S probably damaging Het
Mmp10 C T 9: 7,502,479 P29L probably benign Het
Mroh2b T C 15: 4,905,640 F186L probably damaging Het
Muc4 A T 16: 32,754,952 T1609S unknown Het
Myrfl A T 10: 116,798,640 C616* probably null Het
Ncor1 C T 11: 62,330,859 A946T probably benign Het
Olfr122 C A 17: 37,771,751 L33M probably damaging Het
Olfr330 T C 11: 58,529,201 T262A probably benign Het
Pbp2 T C 6: 135,310,106 Y81C probably benign Het
Plekhh1 C A 12: 79,069,088 Q802K possibly damaging Het
Pnldc1 A T 17: 12,897,278 F279Y probably damaging Het
Psmb5 A T 14: 54,617,804 L63Q probably damaging Het
Rasa3 C T 8: 13,586,873 probably null Het
Rbm4b G A 19: 4,762,191 M209I probably benign Het
Rnf38 A G 4: 44,131,615 S421P probably benign Het
Sema5a T C 15: 32,562,557 V238A probably damaging Het
Sesn1 G T 10: 41,903,775 G402W probably damaging Het
Six4 A G 12: 73,112,406 V260A probably benign Het
Srrm2 G A 17: 23,819,857 R1825Q unknown Het
Stat1 G A 1: 52,139,194 W262* probably null Het
Tgm2 T C 2: 158,120,145 N585D probably benign Het
Tmf1 A T 6: 97,156,860 L1039H probably damaging Het
Trak2 A G 1: 58,935,775 V86A probably benign Het
Ttc39b A G 4: 83,253,010 I202T probably damaging Het
Uhrf1bp1l A T 10: 89,782,720 M274L probably benign Het
Vmn1r30 A G 6: 58,435,475 F124S probably benign Het
Vwa7 T A 17: 35,017,157 F29Y probably damaging Het
Wdr64 A T 1: 175,731,513 M281L probably benign Het
Zfand2a C T 5: 139,481,998 V40M possibly damaging Het
Zfp865 G C 7: 5,031,820 A935P probably damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9268:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9294:Tcf20 UTSW 15 82852696 missense probably benign 0.11
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTGTTCAGAAGGCCCCTG -3'
(R):5'- AGCTCTAACCACAATGGAGAGG -3'

Sequencing Primer
(F):5'- GAAGGCCCCTGCTAGCTAATTC -3'
(R):5'- TCTAACCACAATGGAGAGGGGAATG -3'
Posted On 2021-03-08