Incidental Mutation 'R8728:Olfr122'
ID662611
Institutional Source Beutler Lab
Gene Symbol Olfr122
Ensembl Gene ENSMUSG00000083947
Gene Nameolfactory receptor 122
SynonymsMOR263-10, GA_x6K02T2PSCP-2230932-2231897
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R8728 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37768607-37773749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37771751 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 33 (L33M)
Ref Sequence ENSEMBL: ENSMUSP00000134283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119082] [ENSMUST00000172582] [ENSMUST00000217119]
Predicted Effect probably damaging
Transcript: ENSMUST00000119082
AA Change: L42M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113170
Gene: ENSMUSG00000083947
AA Change: L42M

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 50 320 2.7e-6 PFAM
Pfam:7tm_1 56 305 3.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172582
AA Change: L33M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134283
Gene: ENSMUSG00000083947
AA Change: L33M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 311 9.5e-8 PFAM
Pfam:7tm_1 47 296 7.8e-36 PFAM
Pfam:7tm_4 145 289 1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217119
AA Change: L33M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,312 T514A probably benign Het
Adam2 A G 14: 66,057,637 L253P probably damaging Het
Adamts20 C T 15: 94,331,400 G946D probably benign Het
Afdn A G 17: 13,898,945 R1648G probably damaging Het
Ak9 G A 10: 41,406,963 A1242T Het
Anxa9 T C 3: 95,302,668 K127E probably damaging Het
Atp6v0a2 T C 5: 124,719,088 S739P probably benign Het
Bloc1s6 A T 2: 122,746,106 M122L possibly damaging Het
Bms1 A G 6: 118,392,370 I990T possibly damaging Het
Celsr3 T C 9: 108,846,741 L2899S probably benign Het
Ces1b A T 8: 93,071,948 D203E probably benign Het
Cnnm1 A G 19: 43,484,926 N753S probably benign Het
Col19a1 C T 1: 24,326,032 G501R probably damaging Het
Cym A G 3: 107,218,675 F91L possibly damaging Het
Cyp2c67 T G 19: 39,626,161 R307S probably damaging Het
Cyp3a59 G A 5: 146,098,312 probably null Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dagla G A 19: 10,248,407 R798C probably damaging Het
Dcaf1 C T 9: 106,846,806 R478C possibly damaging Het
Dcbld1 T C 10: 52,233,833 L28P probably benign Het
Ddr2 T C 1: 170,001,983 D234G possibly damaging Het
Fam83a T A 15: 58,009,666 M297K possibly damaging Het
Galnt18 T A 7: 111,520,036 D426V probably damaging Het
Gm10093 A G 17: 78,492,903 K441R probably benign Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 T C 5: 105,290,927 I32V probably benign Het
Gm9944 T C 4: 144,453,031 Y96C unknown Het
Impdh2 C T 9: 108,560,363 probably benign Het
Iws1 G A 18: 32,083,281 R358Q probably damaging Het
Kctd18 G T 1: 57,963,130 D179E probably damaging Het
Krt13 T G 11: 100,121,492 S2R probably null Het
Krt78 A T 15: 101,947,790 S529T probably benign Het
Krtap4-7 C G 11: 99,643,962 C25S unknown Het
Lama1 T C 17: 67,818,668 I2940T Het
Lmnb2 A G 10: 80,905,079 probably null Het
Lrrc27 A T 7: 139,242,639 E482V probably damaging Het
Lrrc72 G A 12: 36,208,657 T67M probably benign Het
Malrd1 T A 2: 15,696,942 C789* probably null Het
Mei1 T G 15: 82,081,981 V268G Het
Mical3 C A 6: 120,973,553 A966S probably damaging Het
Mmp10 C T 9: 7,502,479 P29L probably benign Het
Mroh2b T C 15: 4,905,640 F186L probably damaging Het
Muc4 A T 16: 32,754,952 T1609S unknown Het
Myrfl A T 10: 116,798,640 C616* probably null Het
Ncor1 C T 11: 62,330,859 A946T probably benign Het
Olfr330 T C 11: 58,529,201 T262A probably benign Het
Pbp2 T C 6: 135,310,106 Y81C probably benign Het
Plekhh1 C A 12: 79,069,088 Q802K possibly damaging Het
Pnldc1 A T 17: 12,897,278 F279Y probably damaging Het
Psmb5 A T 14: 54,617,804 L63Q probably damaging Het
Rasa3 C T 8: 13,586,873 probably null Het
Rbm4b G A 19: 4,762,191 M209I probably benign Het
Rnf38 A G 4: 44,131,615 S421P probably benign Het
Sema5a T C 15: 32,562,557 V238A probably damaging Het
Sesn1 G T 10: 41,903,775 G402W probably damaging Het
Six4 A G 12: 73,112,406 V260A probably benign Het
Srrm2 G A 17: 23,819,857 R1825Q unknown Het
Stat1 G A 1: 52,139,194 W262* probably null Het
Tcf20 A T 15: 82,854,957 D764E probably damaging Het
Tgm2 T C 2: 158,120,145 N585D probably benign Het
Tmf1 A T 6: 97,156,860 L1039H probably damaging Het
Trak2 A G 1: 58,935,775 V86A probably benign Het
Ttc39b A G 4: 83,253,010 I202T probably damaging Het
Uhrf1bp1l A T 10: 89,782,720 M274L probably benign Het
Vmn1r30 A G 6: 58,435,475 F124S probably benign Het
Vwa7 T A 17: 35,017,157 F29Y probably damaging Het
Wdr64 A T 1: 175,731,513 M281L probably benign Het
Zfand2a C T 5: 139,481,998 V40M possibly damaging Het
Zfp865 G C 7: 5,031,820 A935P probably damaging Het
Other mutations in Olfr122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Olfr122 APN 17 37772614 missense probably benign 0.00
IGL01338:Olfr122 APN 17 37771839 missense possibly damaging 0.90
IGL01447:Olfr122 APN 17 37772231 missense probably damaging 1.00
PIT4514001:Olfr122 UTSW 17 37771867 missense probably damaging 1.00
R0402:Olfr122 UTSW 17 37772393 missense probably damaging 1.00
R0830:Olfr122 UTSW 17 37771913 missense probably damaging 0.99
R2018:Olfr122 UTSW 17 37772576 missense probably benign 0.00
R4258:Olfr122 UTSW 17 37772058 missense probably damaging 1.00
R6371:Olfr122 UTSW 17 37772435 missense probably benign
R6481:Olfr122 UTSW 17 37772303 missense probably damaging 1.00
R7468:Olfr122 UTSW 17 37772019 missense probably damaging 1.00
R7492:Olfr122 UTSW 17 37771680 missense possibly damaging 0.53
R8114:Olfr122 UTSW 17 37771989 missense possibly damaging 0.67
R8172:Olfr122 UTSW 17 37772435 missense probably benign
Z1177:Olfr122 UTSW 17 37772191 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATTTTAGACACACGCACATGCAAG -3'
(R):5'- ACAAGGCTCTGTAACATCTTGGG -3'

Sequencing Primer
(F):5'- CACACGCACATGCAAGAGGAAG -3'
(R):5'- CTGTAACATCTTGGGTATGACAGAGC -3'
Posted On2021-03-08