Incidental Mutation 'R8728:Gm10093'
ID 662613
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Name predicted pseudogene 10093
Synonyms EG15181
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R8728 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78491565-78493541 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78492903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 441 (K441R)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079363
AA Change: K441R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: K441R

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,312 T514A probably benign Het
Adam2 A G 14: 66,057,637 L253P probably damaging Het
Adamts20 C T 15: 94,331,400 G946D probably benign Het
Afdn A G 17: 13,898,945 R1648G probably damaging Het
Ak9 G A 10: 41,406,963 A1242T Het
Anxa9 T C 3: 95,302,668 K127E probably damaging Het
Atp6v0a2 T C 5: 124,719,088 S739P probably benign Het
Bloc1s6 A T 2: 122,746,106 M122L possibly damaging Het
Bms1 A G 6: 118,392,370 I990T possibly damaging Het
Cdk14 G A 5: 5,420,117 silent Het
Celsr3 T C 9: 108,846,741 L2899S probably benign Het
Ces1b A T 8: 93,071,948 D203E probably benign Het
Cnnm1 A G 19: 43,484,926 N753S probably benign Het
Col19a1 C T 1: 24,326,032 G501R probably damaging Het
Cym A G 3: 107,218,675 F91L possibly damaging Het
Cyp2c67 T G 19: 39,626,161 R307S probably damaging Het
Cyp3a59 G A 5: 146,098,312 probably null Het
Cyp4a31 G A 4: 115,565,028 E70K probably benign Het
Dagla G A 19: 10,248,407 R798C probably damaging Het
Dcaf1 C T 9: 106,846,806 R478C possibly damaging Het
Dcbld1 T C 10: 52,233,833 L28P probably benign Het
Ddr2 T C 1: 170,001,983 D234G possibly damaging Het
Fam83a T A 15: 58,009,666 M297K possibly damaging Het
Galnt18 T A 7: 111,520,036 D426V probably damaging Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 T C 5: 105,290,927 I32V probably benign Het
Gm9944 T C 4: 144,453,031 Y96C unknown Het
Impdh2 C T 9: 108,560,363 probably benign Het
Iws1 G A 18: 32,083,281 R358Q probably damaging Het
Kctd18 G T 1: 57,963,130 D179E probably damaging Het
Krt13 T G 11: 100,121,492 S2R probably null Het
Krt78 A T 15: 101,947,790 S529T probably benign Het
Krtap4-7 C G 11: 99,643,962 C25S unknown Het
Lama1 T C 17: 67,818,668 I2940T Het
Lmnb2 A G 10: 80,905,079 probably null Het
Lrrc27 A T 7: 139,242,639 E482V probably damaging Het
Lrrc72 G A 12: 36,208,657 T67M probably benign Het
Malrd1 T A 2: 15,696,942 C789* probably null Het
Mei1 T G 15: 82,081,981 V268G Het
Mical3 C A 6: 120,973,553 A966S probably damaging Het
Mmp10 C T 9: 7,502,479 P29L probably benign Het
Mroh2b T C 15: 4,905,640 F186L probably damaging Het
Muc4 A T 16: 32,754,952 T1609S unknown Het
Myrfl A T 10: 116,798,640 C616* probably null Het
Ncor1 C T 11: 62,330,859 A946T probably benign Het
Olfr122 C A 17: 37,771,751 L33M probably damaging Het
Olfr330 T C 11: 58,529,201 T262A probably benign Het
Pbp2 T C 6: 135,310,106 Y81C probably benign Het
Plekhh1 C A 12: 79,069,088 Q802K possibly damaging Het
Pnldc1 A T 17: 12,897,278 F279Y probably damaging Het
Psmb5 A T 14: 54,617,804 L63Q probably damaging Het
Rasa3 C T 8: 13,586,873 probably null Het
Rbm4b G A 19: 4,762,191 M209I probably benign Het
Rnf38 A G 4: 44,131,615 S421P probably benign Het
Sema5a T C 15: 32,562,557 V238A probably damaging Het
Sesn1 G T 10: 41,903,775 G402W probably damaging Het
Six4 A G 12: 73,112,406 V260A probably benign Het
Srrm2 G A 17: 23,819,857 R1825Q unknown Het
Stat1 G A 1: 52,139,194 W262* probably null Het
Tcf20 A T 15: 82,854,957 D764E probably damaging Het
Tgm2 T C 2: 158,120,145 N585D probably benign Het
Tmf1 A T 6: 97,156,860 L1039H probably damaging Het
Trak2 A G 1: 58,935,775 V86A probably benign Het
Ttc39b A G 4: 83,253,010 I202T probably damaging Het
Uhrf1bp1l A T 10: 89,782,720 M274L probably benign Het
Vmn1r30 A G 6: 58,435,475 F124S probably benign Het
Vwa7 T A 17: 35,017,157 F29Y probably damaging Het
Wdr64 A T 1: 175,731,513 M281L probably benign Het
Zfand2a C T 5: 139,481,998 V40M possibly damaging Het
Zfp865 G C 7: 5,031,820 A935P probably damaging Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
buttress UTSW 17 78492914 missense possibly damaging 0.91
Chartre UTSW 17 78492540 missense probably damaging 0.99
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R8821:Gm10093 UTSW 17 78492540 missense probably damaging 0.99
R8920:Gm10093 UTSW 17 78491742 missense probably benign 0.37
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAACTTGAGGATGCTGCCC -3'
(R):5'- TTCTTTCCACGCAAATGGGG -3'

Sequencing Primer
(F):5'- TGAGGATGCTGCCCCATGC -3'
(R):5'- ATGGACAAGGTCGCTCTGG -3'
Posted On 2021-03-08