Mutagenetix > Incidental Mutation

Incidental Mutation 'R8729:Gpat2'

662623

Institutional Source

Beutler Lab

Gene Symbol

Gpat2

Ensembl Gene

ENSMUSG00000046338

Gene Name

glycerol-3-phosphate acyltransferase 2, mitochondrial

Synonyms

Gpat2, A530057A03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8729 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127425199-127436092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 127433819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 506 (Q506K)

Ref Sequence

ENSEMBL: ENSMUSP00000049619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]

AlphaFold

Q14DK4

Predicted Effect

probably benign
Transcript: ENSMUST00000028848

SMART Domains

Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

Domain	Start	End	E-Value	Type
low complexity region	47	53	N/A	INTRINSIC
Pfam:FAA_hydrolase	107	313	3.1e-75	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000062211
AA Change: Q506K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: Q506K

Domain	Start	End	E-Value	Type
PlsC	199	333	1.45e-11	SMART
Blast:PlsC	347	387	7e-13	BLAST
low complexity region	431	468	N/A	INTRINSIC
low complexity region	515	528	N/A	INTRINSIC
low complexity region	593	613	N/A	INTRINSIC
low complexity region	664	675	N/A	INTRINSIC

Meta Mutation Damage Score

0.2090

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 97.9%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	C	A	6: 116,651,801	P35H	probably damaging	Het
Adam4	A	T	12: 81,421,402	Y148*	probably null	Het
Ank3	A	G	10: 70,002,598	D1812G	possibly damaging	Het
Ankrd17	C	T	5: 90,295,593	C405Y	probably benign	Het
Ankrd61	A	G	5: 143,890,985	Y391H	probably benign	Het
Calcb	A	C	7: 114,720,193	E70A	probably benign	Het
Ccr1	T	C	9: 123,963,794	K233R	probably benign	Het
Ccz1	T	C	5: 144,011,492	D115G	probably damaging	Het
Col14a1	T	A	15: 55,447,497	L1203*	probably null	Het
Csmd2	G	A	4: 128,462,845	D1648N		Het
Csn1s1	T	C	5: 87,677,139		probably null	Het
Eif2ak3	C	A	6: 70,844,880	P52Q	probably benign	Het
Fam129b	T	A	2: 32,909,934	L91Q	probably damaging	Het
Galnt18	T	C	7: 111,519,991	E441G	probably null	Het
Gm21671	A	G	5: 25,953,180	V58A	probably damaging	Het
Gramd1a	C	A	7: 31,143,823	R20L	possibly damaging	Het
Helz	G	T	11: 107,637,928		probably null	Het
Hif1a	A	G	12: 73,944,128	N725D	probably damaging	Het
Ighv3-3	A	T	12: 114,196,632	W53R	possibly damaging	Het
Kat2a	T	C	11: 100,710,511	K331R	probably benign	Het
Klk1b4	T	A	7: 44,207,460	F3I	probably damaging	Het
Krt78	T	G	15: 101,947,020	Q785H	probably damaging	Het
Lsm11	C	T	11: 45,944,900	E5K	possibly damaging	Het
Luzp2	A	G	7: 55,167,237	K145R	probably damaging	Het
Man2b2	T	C	5: 36,816,118	T506A	probably benign	Het
Msrb3	A	C	10: 120,852,069	C34G	probably null	Het
Muc16	T	C	9: 18,660,050	D391G	unknown	Het
Mybpc2	C	T	7: 44,506,187	V881M	probably damaging	Het
Myh15	A	G	16: 49,061,488	K31R	probably damaging	Het
Ndnf	A	T	6: 65,703,774	K346*	probably null	Het
Nfs1	G	A	2: 156,123,807	T118I	probably benign	Het
Nlrp9c	T	G	7: 26,372,003	K893N	probably benign	Het
Nmd3	A	T	3: 69,748,349	K454N	possibly damaging	Het
Olfr290	T	C	7: 84,916,315	C179R	probably damaging	Het
Pcdhb9	C	A	18: 37,402,586	D544E	possibly damaging	Het
Pck1	A	G	2: 173,156,073	I312V	probably damaging	Het
Pkd2l2	G	A	18: 34,433,301	V522I	probably benign	Het
Polr3c	C	T	3: 96,727,480		probably benign	Het
Prkd2	T	A	7: 16,849,127	H271Q	probably damaging	Het
Rpp21	A	G	17: 36,256,035	S59P	probably benign	Het
Rxfp4	T	A	3: 88,651,998	N382I	unknown	Het
Sirt1	A	G	10: 63,320,926	F642L	probably damaging	Het
Sp2	T	C	11: 96,961,273	D275G	possibly damaging	Het
Srp72	C	T	5: 76,994,158	T414I	probably benign	Het
Syne1	T	A	10: 5,229,275	M4400L	probably benign	Het
Tbx15	A	T	3: 99,313,060	H156L	possibly damaging	Het
Tbxas1	G	T	6: 39,001,338	M140I	probably benign	Het
Tcof1	G	T	18: 60,829,073	P695T	unknown	Het
Tmprss9	A	T	10: 80,890,343	M476L	probably benign	Het
Trat1	A	T	16: 48,742,228	I73N	probably damaging	Het
Trp53bp2	A	T	1: 182,449,022	E856V	probably benign	Het
Ttc28	T	A	5: 111,235,643		probably null	Het
Ttn	AC	A	2: 76,919,184		probably null	Het
Twf1	T	C	15: 94,581,331	N216D	probably benign	Het
Unc80	C	A	1: 66,608,490	H1530N	probably benign	Het
Vmn1r235	A	T	17: 21,261,613	M67L	probably benign	Het
Vmn2r111	A	T	17: 22,548,258	Y753N	probably damaging	Het
Zkscan5	T	A	5: 145,220,261	N524K	probably benign	Het

Other mutations in Gpat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Gpat2	APN	2	127432396	missense	probably benign	0.01
IGL00479:Gpat2	APN	2	127434461	missense	probably damaging	0.99
IGL01393:Gpat2	APN	2	127432651	missense	probably damaging	1.00
IGL01759:Gpat2	APN	2	127430896	missense	possibly damaging	0.94
IGL01764:Gpat2	APN	2	127427536	missense	probably benign	0.18
IGL02631:Gpat2	APN	2	127434232	splice site	probably benign
IGL02657:Gpat2	APN	2	127427331	missense	probably benign	0.04
IGL02813:Gpat2	APN	2	127434455	missense	possibly damaging	0.90
IGL02873:Gpat2	APN	2	127431755	missense	probably benign	0.00
IGL02993:Gpat2	APN	2	127427566	missense	probably damaging	1.00
Hygroscopic	UTSW	2	127431918	missense	possibly damaging	0.90
PIT4494001:Gpat2	UTSW	2	127433880	missense	probably benign	0.00
R0078:Gpat2	UTSW	2	127428249	missense	probably damaging	1.00
R0230:Gpat2	UTSW	2	127435845	missense	possibly damaging	0.95
R1619:Gpat2	UTSW	2	127428717	missense	probably benign	0.00
R1851:Gpat2	UTSW	2	127434819	missense	possibly damaging	0.77
R1939:Gpat2	UTSW	2	127435959	makesense	probably null
R2143:Gpat2	UTSW	2	127433762	missense	probably damaging	1.00
R2165:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R2518:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3410:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3411:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3898:Gpat2	UTSW	2	127435098	missense	probably damaging	1.00
R4080:Gpat2	UTSW	2	127433622	missense	probably damaging	0.99
R4725:Gpat2	UTSW	2	127431982	missense	possibly damaging	0.83
R4841:Gpat2	UTSW	2	127433967	missense	probably benign	0.10
R5354:Gpat2	UTSW	2	127428723	missense	probably damaging	1.00
R5941:Gpat2	UTSW	2	127428275	missense	possibly damaging	0.53
R6362:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6374:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6375:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6377:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6380:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6381:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6382:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6383:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6384:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6393:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6565:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6594:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6595:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6649:Gpat2	UTSW	2	127432435	missense	possibly damaging	0.81
R6665:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6666:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6667:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6668:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6669:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R7031:Gpat2	UTSW	2	127435475	missense	probably damaging	0.99
R7096:Gpat2	UTSW	2	127428289	missense	probably benign	0.02
R7307:Gpat2	UTSW	2	127434890	missense	probably damaging	1.00
R7313:Gpat2	UTSW	2	127428295	missense	probably damaging	0.99
R7365:Gpat2	UTSW	2	127426981	splice site	probably null
R8111:Gpat2	UTSW	2	127433857	missense	probably damaging	1.00
R8113:Gpat2	UTSW	2	127431347	missense	possibly damaging	0.52
R9010:Gpat2	UTSW	2	127435226	missense	probably benign	0.28
R9146:Gpat2	UTSW	2	127431286	missense	possibly damaging	0.58
Z1176:Gpat2	UTSW	2	127430882	missense	probably benign
Z1176:Gpat2	UTSW	2	127433808	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGGCCACACTGCTTTTG -3'
(R):5'- CATGCATCCCAATCCTGCTGAC -3'

Sequencing Primer
(F):5'- GCTGAAGCACCAAAAGGTAAGGC -3'
(R):5'- TGCTGACCCACTGACTCAC -3'

Posted On

2021-03-08