Incidental Mutation 'R8729:Tbx15'
ID 662629
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms de, Tbx14, Tbx8
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R8729 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99240381-99354259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99313060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 156 (H156L)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: H156L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: H156L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150756
AA Change: H50L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: H50L

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151606
AA Change: H50L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868
AA Change: H50L

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Galnt18 T C 7: 111,519,991 E441G probably null Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Helz G T 11: 107,637,928 probably null Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Ndnf A T 6: 65,703,774 K346* probably null Het
Nfs1 G A 2: 156,123,807 T118I probably benign Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Pkd2l2 G A 18: 34,433,301 V522I probably benign Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rpp21 A G 17: 36,256,035 S59P probably benign Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttc28 T A 5: 111,235,643 probably null Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99316246 missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99316228 missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99313042 missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99352484 missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99352510 missense probably benign 0.01
IGL03143:Tbx15 APN 3 99352198 missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99351980 missense probably benign 0.00
shin_guard UTSW 3 99352192 missense possibly damaging 0.90
Shortcut UTSW 3 99313073 nonsense probably null
R0012:Tbx15 UTSW 3 99352096 missense probably benign
R0109:Tbx15 UTSW 3 99351866 missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99352391 missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99316318 missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99316323 missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99351912 missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99351824 splice site probably null
R1762:Tbx15 UTSW 3 99351944 nonsense probably null
R1789:Tbx15 UTSW 3 99352246 nonsense probably null
R2167:Tbx15 UTSW 3 99326455 splice site probably benign
R2254:Tbx15 UTSW 3 99351874 missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99316356 splice site probably null
R2441:Tbx15 UTSW 3 99352511 missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99253893 intron probably benign
R3118:Tbx15 UTSW 3 99352154 missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99313054 missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99352367 missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99352267 missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99326384 missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99254074 missense probably benign 0.06
R4999:Tbx15 UTSW 3 99316333 missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99352046 missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99316284 missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99352192 missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99352564 missense probably benign
R5690:Tbx15 UTSW 3 99308850 missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99313086 missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6156:Tbx15 UTSW 3 99313115 critical splice donor site probably null
R6173:Tbx15 UTSW 3 99253887 nonsense probably null
R6596:Tbx15 UTSW 3 99352192 missense probably benign
R6680:Tbx15 UTSW 3 99313073 nonsense probably null
R6931:Tbx15 UTSW 3 99352151 missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99253938 missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99352570 missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99351989 missense probably damaging 1.00
R8929:Tbx15 UTSW 3 99314903 missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99314769 missense probably benign 0.14
R9688:Tbx15 UTSW 3 99326392 missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99352331 missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99314835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGTCTCCATCACAGTTTACAG -3'
(R):5'- TGTTTCCTGCCTGGGATCAC -3'

Sequencing Primer
(F):5'- GGTCTCCATCACAGTTTACAGTGATC -3'
(R):5'- GGATCACAGACCATTGGTGTATCC -3'
Posted On 2021-03-08