Incidental Mutation 'R8729:Tbx15'
ID 662629
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 068577-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R8729 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99220376 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 156 (H156L)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: H156L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: H156L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150756
AA Change: H50L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: H50L

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151606
AA Change: H50L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868
AA Change: H50L

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,468,176 (GRCm39) Y148* probably null Het
Ank3 A G 10: 69,838,428 (GRCm39) D1812G possibly damaging Het
Ankrd17 C T 5: 90,443,452 (GRCm39) C405Y probably benign Het
Ankrd61 A G 5: 143,827,803 (GRCm39) Y391H probably benign Het
Calcb A C 7: 114,319,428 (GRCm39) E70A probably benign Het
Ccr1 T C 9: 123,763,831 (GRCm39) K233R probably benign Het
Ccz1 T C 5: 143,948,310 (GRCm39) D115G probably damaging Het
Col14a1 T A 15: 55,310,893 (GRCm39) L1203* probably null Het
Csmd2 G A 4: 128,356,638 (GRCm39) D1648N Het
Csn1s1 T C 5: 87,824,998 (GRCm39) probably null Het
Depp1 C A 6: 116,628,762 (GRCm39) P35H probably damaging Het
Eif2ak3 C A 6: 70,821,864 (GRCm39) P52Q probably benign Het
Galnt18 T C 7: 111,119,198 (GRCm39) E441G probably null Het
Gpat2 C A 2: 127,275,739 (GRCm39) Q506K probably damaging Het
Gramd1a C A 7: 30,843,248 (GRCm39) R20L possibly damaging Het
Helz G T 11: 107,528,754 (GRCm39) probably null Het
Hif1a A G 12: 73,990,902 (GRCm39) N725D probably damaging Het
Ighv3-3 A T 12: 114,160,252 (GRCm39) W53R possibly damaging Het
Kat2a T C 11: 100,601,337 (GRCm39) K331R probably benign Het
Klk1b4 T A 7: 43,856,884 (GRCm39) F3I probably damaging Het
Krt78 T G 15: 101,855,455 (GRCm39) Q785H probably damaging Het
Lsm11 C T 11: 45,835,727 (GRCm39) E5K possibly damaging Het
Luzp2 A G 7: 54,816,985 (GRCm39) K145R probably damaging Het
Man2b2 T C 5: 36,973,462 (GRCm39) T506A probably benign Het
Msrb3 A C 10: 120,687,974 (GRCm39) C34G probably null Het
Muc16 T C 9: 18,571,346 (GRCm39) D391G unknown Het
Mybpc2 C T 7: 44,155,611 (GRCm39) V881M probably damaging Het
Myh15 A G 16: 48,881,851 (GRCm39) K31R probably damaging Het
Ndnf A T 6: 65,680,758 (GRCm39) K346* probably null Het
Nfs1 G A 2: 155,965,727 (GRCm39) T118I probably benign Het
Niban2 T A 2: 32,799,946 (GRCm39) L91Q probably damaging Het
Nlrp9c T G 7: 26,071,428 (GRCm39) K893N probably benign Het
Nmd3 A T 3: 69,655,682 (GRCm39) K454N possibly damaging Het
Or5ae1 T C 7: 84,565,523 (GRCm39) C179R probably damaging Het
Pcdhb9 C A 18: 37,535,639 (GRCm39) D544E possibly damaging Het
Pck1 A G 2: 172,997,866 (GRCm39) I312V probably damaging Het
Pkd2l2 G A 18: 34,566,354 (GRCm39) V522I probably benign Het
Polr3c C T 3: 96,634,796 (GRCm39) probably benign Het
Prkd2 T A 7: 16,583,052 (GRCm39) H271Q probably damaging Het
Rpp21 A G 17: 36,566,927 (GRCm39) S59P probably benign Het
Rxfp4 T A 3: 88,559,305 (GRCm39) N382I unknown Het
Sirt1 A G 10: 63,156,705 (GRCm39) F642L probably damaging Het
Sp2 T C 11: 96,852,099 (GRCm39) D275G possibly damaging Het
Speer4a3 A G 5: 26,158,178 (GRCm39) V58A probably damaging Het
Srp72 C T 5: 77,142,005 (GRCm39) T414I probably benign Het
Syne1 T A 10: 5,179,275 (GRCm39) M4400L probably benign Het
Tbxas1 G T 6: 38,978,272 (GRCm39) M140I probably benign Het
Tcof1 G T 18: 60,962,145 (GRCm39) P695T unknown Het
Tmprss9 A T 10: 80,726,177 (GRCm39) M476L probably benign Het
Trat1 A T 16: 48,562,591 (GRCm39) I73N probably damaging Het
Trp53bp2 A T 1: 182,276,587 (GRCm39) E856V probably benign Het
Ttc28 T A 5: 111,383,509 (GRCm39) probably null Het
Ttn AC A 2: 76,749,528 (GRCm39) probably null Het
Twf1 T C 15: 94,479,212 (GRCm39) N216D probably benign Het
Unc80 C A 1: 66,647,649 (GRCm39) H1530N probably benign Het
Vmn1r235 A T 17: 21,481,875 (GRCm39) M67L probably benign Het
Vmn2r111 A T 17: 22,767,239 (GRCm39) Y753N probably damaging Het
Zkscan5 T A 5: 145,157,071 (GRCm39) N524K probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGTCTCCATCACAGTTTACAG -3'
(R):5'- TGTTTCCTGCCTGGGATCAC -3'

Sequencing Primer
(F):5'- GGTCTCCATCACAGTTTACAGTGATC -3'
(R):5'- GGATCACAGACCATTGGTGTATCC -3'
Posted On 2021-03-08