Incidental Mutation 'R8729:Ttc28'
ID662636
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8729 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 111235643 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect probably null
Transcript: ENSMUST00000040111
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156290
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Galnt18 T C 7: 111,519,991 E441G probably null Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Helz G T 11: 107,637,928 probably null Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Ndnf A T 6: 65,703,774 K346* probably null Het
Nfs1 G A 2: 156,123,807 T118I probably benign Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Pkd2l2 G A 18: 34,433,301 V522I probably benign Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbx15 A T 3: 99,313,060 H156L possibly damaging Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
R7350:Ttc28 UTSW 5 111226037 missense probably damaging 0.97
R7454:Ttc28 UTSW 5 111285484 missense probably benign 0.19
R7461:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7596:Ttc28 UTSW 5 111280124 missense probably damaging 1.00
R7613:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7625:Ttc28 UTSW 5 111285219 missense possibly damaging 0.65
R7648:Ttc28 UTSW 5 111183392 missense possibly damaging 0.52
R7735:Ttc28 UTSW 5 111266678 splice site probably null
R8030:Ttc28 UTSW 5 111286056 missense possibly damaging 0.81
R8205:Ttc28 UTSW 5 111225730 missense possibly damaging 0.95
R8246:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8247:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8269:Ttc28 UTSW 5 111277459 missense probably benign 0.09
R8292:Ttc28 UTSW 5 111223257 missense probably damaging 1.00
R8346:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8356:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8423:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8424:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8426:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8441:Ttc28 UTSW 5 111177641 nonsense probably null
R8494:Ttc28 UTSW 5 111235640 missense probably damaging 0.96
R8508:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8510:Ttc28 UTSW 5 111233341 missense probably benign 0.33
R8845:Ttc28 UTSW 5 111224175 missense probably benign 0.11
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Z1176:Ttc28 UTSW 5 111266566 missense possibly damaging 0.59
Z1177:Ttc28 UTSW 5 111278586 missense probably damaging 1.00
Z1177:Ttc28 UTSW 5 111285739 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGCTACCCAACCATGTGTGAC -3'
(R):5'- CCAGCTCAGGGGATTGTAATG -3'

Sequencing Primer
(F):5'- AACCATGTGTGACCTTGCCATG -3'
(R):5'- CTCAGGGGATTGTAATGAAAGATG -3'
Posted On2021-03-08