Incidental Mutation 'R8729:Ndnf'
ID662641
Institutional Source Beutler Lab
Gene Symbol Ndnf
Ensembl Gene ENSMUSG00000049001
Gene Nameneuron-derived neurotrophic factor
SynonymsA930038C07Rik, epidermacan
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8729 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location65671590-65712326 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 65703774 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 346 (K346*)
Ref Sequence ENSEMBL: ENSMUSP00000051297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054351]
Predicted Effect probably null
Transcript: ENSMUST00000054351
AA Change: K346*
SMART Domains Protein: ENSMUSP00000051297
Gene: ENSMUSG00000049001
AA Change: K346*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:FN3 71 161 2e-33 BLAST
FN3 174 324 5.75e-2 SMART
FN3 445 554 1.62e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Galnt18 T C 7: 111,519,991 E441G probably null Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Helz G T 11: 107,637,928 probably null Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Nfs1 G A 2: 156,123,807 T118I probably benign Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Pkd2l2 G A 18: 34,433,301 V522I probably benign Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbx15 A T 3: 99,313,060 H156L possibly damaging Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttc28 T A 5: 111,235,643 probably null Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Ndnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Ndnf APN 6 65703258 missense probably damaging 1.00
IGL01737:Ndnf APN 6 65703555 missense probably benign 0.15
IGL03000:Ndnf APN 6 65703315 missense possibly damaging 0.95
IGL03236:Ndnf APN 6 65696172 missense possibly damaging 0.74
IGL03373:Ndnf APN 6 65704288 missense possibly damaging 0.47
K3955:Ndnf UTSW 6 65701429 splice site probably benign
R1457:Ndnf UTSW 6 65704014 missense possibly damaging 0.82
R1670:Ndnf UTSW 6 65703070 missense probably benign 0.00
R1687:Ndnf UTSW 6 65703423 missense probably benign 0.00
R1909:Ndnf UTSW 6 65703313 missense possibly damaging 0.94
R3951:Ndnf UTSW 6 65703141 missense possibly damaging 0.79
R4043:Ndnf UTSW 6 65703936 missense possibly damaging 0.89
R4465:Ndnf UTSW 6 65704196 missense probably benign
R4983:Ndnf UTSW 6 65703571 missense possibly damaging 0.89
R5271:Ndnf UTSW 6 65703666 missense possibly damaging 0.52
R6785:Ndnf UTSW 6 65703063 missense probably benign 0.01
R7874:Ndnf UTSW 6 65703429 missense probably benign
R8049:Ndnf UTSW 6 65703430 missense probably benign 0.04
R8398:Ndnf UTSW 6 65704378 missense probably damaging 0.99
R8853:Ndnf UTSW 6 65703177 missense probably benign 0.06
RF017:Ndnf UTSW 6 65704329 missense probably damaging 0.97
X0066:Ndnf UTSW 6 65701517 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTTCTCCCAAAGTGG -3'
(R):5'- CTGAAACTGCCGAATGCCTTC -3'

Sequencing Primer
(F):5'- AGGCCCAAGGTTGACATTC -3'
(R):5'- GAATGCCTTCCACATTCTGTG -3'
Posted On2021-03-08