Incidental Mutation 'R8729:Helz'
ID662663
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8729 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 107637928 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably null
Transcript: ENSMUST00000075012
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100305
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106746
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133862
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Galnt18 T C 7: 111,519,991 E441G probably null Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Ndnf A T 6: 65,703,774 K346* probably null Het
Nfs1 G A 2: 156,123,807 T118I probably benign Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Pkd2l2 G A 18: 34,433,301 V522I probably benign Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbx15 A T 3: 99,313,060 H156L possibly damaging Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttc28 T A 5: 111,235,643 probably null Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R7982:Helz UTSW 11 107626630 missense possibly damaging 0.84
R8024:Helz UTSW 11 107686421 missense unknown
R8181:Helz UTSW 11 107672573 missense unknown
R8346:Helz UTSW 11 107672573 missense unknown
R8807:Helz UTSW 11 107603009 missense probably damaging 1.00
R8821:Helz UTSW 11 107635093 missense probably damaging 0.99
R8891:Helz UTSW 11 107662016 missense probably damaging 0.99
R8909:Helz UTSW 11 107666008 missense possibly damaging 0.94
R8922:Helz UTSW 11 107649159 missense possibly damaging 0.90
R8926:Helz UTSW 11 107672683 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACTTGGCTGACAGATGC -3'
(R):5'- GCGCTATGACAGAATACGTTGG -3'

Sequencing Primer
(F):5'- AGATGCTCTGTTCTGCTTCC -3'
(R):5'- GCTATGACAGAATACGTTGGCTTTTC -3'
Posted On2021-03-08