Incidental Mutation 'R8729:Helz'
ID 662663
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Name helicase with zinc finger domain
Synonyms 3110078M01Rik, 9430093I07Rik, 9630002H22Rik
MMRRC Submission 068577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8729 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 107438756-107584652 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 107528754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
AlphaFold Q6DFV5
Predicted Effect probably null
Transcript: ENSMUST00000075012
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100305
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106746
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133862
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Meta Mutation Damage Score 0.9505 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,468,176 (GRCm39) Y148* probably null Het
Ank3 A G 10: 69,838,428 (GRCm39) D1812G possibly damaging Het
Ankrd17 C T 5: 90,443,452 (GRCm39) C405Y probably benign Het
Ankrd61 A G 5: 143,827,803 (GRCm39) Y391H probably benign Het
Calcb A C 7: 114,319,428 (GRCm39) E70A probably benign Het
Ccr1 T C 9: 123,763,831 (GRCm39) K233R probably benign Het
Ccz1 T C 5: 143,948,310 (GRCm39) D115G probably damaging Het
Col14a1 T A 15: 55,310,893 (GRCm39) L1203* probably null Het
Csmd2 G A 4: 128,356,638 (GRCm39) D1648N Het
Csn1s1 T C 5: 87,824,998 (GRCm39) probably null Het
Depp1 C A 6: 116,628,762 (GRCm39) P35H probably damaging Het
Eif2ak3 C A 6: 70,821,864 (GRCm39) P52Q probably benign Het
Galnt18 T C 7: 111,119,198 (GRCm39) E441G probably null Het
Gpat2 C A 2: 127,275,739 (GRCm39) Q506K probably damaging Het
Gramd1a C A 7: 30,843,248 (GRCm39) R20L possibly damaging Het
Hif1a A G 12: 73,990,902 (GRCm39) N725D probably damaging Het
Ighv3-3 A T 12: 114,160,252 (GRCm39) W53R possibly damaging Het
Kat2a T C 11: 100,601,337 (GRCm39) K331R probably benign Het
Klk1b4 T A 7: 43,856,884 (GRCm39) F3I probably damaging Het
Krt78 T G 15: 101,855,455 (GRCm39) Q785H probably damaging Het
Lsm11 C T 11: 45,835,727 (GRCm39) E5K possibly damaging Het
Luzp2 A G 7: 54,816,985 (GRCm39) K145R probably damaging Het
Man2b2 T C 5: 36,973,462 (GRCm39) T506A probably benign Het
Msrb3 A C 10: 120,687,974 (GRCm39) C34G probably null Het
Muc16 T C 9: 18,571,346 (GRCm39) D391G unknown Het
Mybpc2 C T 7: 44,155,611 (GRCm39) V881M probably damaging Het
Myh15 A G 16: 48,881,851 (GRCm39) K31R probably damaging Het
Ndnf A T 6: 65,680,758 (GRCm39) K346* probably null Het
Nfs1 G A 2: 155,965,727 (GRCm39) T118I probably benign Het
Niban2 T A 2: 32,799,946 (GRCm39) L91Q probably damaging Het
Nlrp9c T G 7: 26,071,428 (GRCm39) K893N probably benign Het
Nmd3 A T 3: 69,655,682 (GRCm39) K454N possibly damaging Het
Or5ae1 T C 7: 84,565,523 (GRCm39) C179R probably damaging Het
Pcdhb9 C A 18: 37,535,639 (GRCm39) D544E possibly damaging Het
Pck1 A G 2: 172,997,866 (GRCm39) I312V probably damaging Het
Pkd2l2 G A 18: 34,566,354 (GRCm39) V522I probably benign Het
Polr3c C T 3: 96,634,796 (GRCm39) probably benign Het
Prkd2 T A 7: 16,583,052 (GRCm39) H271Q probably damaging Het
Rpp21 A G 17: 36,566,927 (GRCm39) S59P probably benign Het
Rxfp4 T A 3: 88,559,305 (GRCm39) N382I unknown Het
Sirt1 A G 10: 63,156,705 (GRCm39) F642L probably damaging Het
Sp2 T C 11: 96,852,099 (GRCm39) D275G possibly damaging Het
Speer4a3 A G 5: 26,158,178 (GRCm39) V58A probably damaging Het
Srp72 C T 5: 77,142,005 (GRCm39) T414I probably benign Het
Syne1 T A 10: 5,179,275 (GRCm39) M4400L probably benign Het
Tbx15 A T 3: 99,220,376 (GRCm39) H156L possibly damaging Het
Tbxas1 G T 6: 38,978,272 (GRCm39) M140I probably benign Het
Tcof1 G T 18: 60,962,145 (GRCm39) P695T unknown Het
Tmprss9 A T 10: 80,726,177 (GRCm39) M476L probably benign Het
Trat1 A T 16: 48,562,591 (GRCm39) I73N probably damaging Het
Trp53bp2 A T 1: 182,276,587 (GRCm39) E856V probably benign Het
Ttc28 T A 5: 111,383,509 (GRCm39) probably null Het
Ttn AC A 2: 76,749,528 (GRCm39) probably null Het
Twf1 T C 15: 94,479,212 (GRCm39) N216D probably benign Het
Unc80 C A 1: 66,647,649 (GRCm39) H1530N probably benign Het
Vmn1r235 A T 17: 21,481,875 (GRCm39) M67L probably benign Het
Vmn2r111 A T 17: 22,767,239 (GRCm39) Y753N probably damaging Het
Zkscan5 T A 5: 145,157,071 (GRCm39) N524K probably benign Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107,554,479 (GRCm39) missense possibly damaging 0.90
IGL01419:Helz APN 11 107,577,340 (GRCm39) missense unknown
IGL01864:Helz APN 11 107,493,180 (GRCm39) missense probably damaging 0.98
IGL01999:Helz APN 11 107,493,754 (GRCm39) splice site probably benign
IGL02938:Helz APN 11 107,577,264 (GRCm39) missense unknown
IGL03157:Helz APN 11 107,468,714 (GRCm39) missense possibly damaging 0.95
IGL03374:Helz APN 11 107,510,973 (GRCm39) missense probably damaging 0.98
R0058:Helz UTSW 11 107,563,384 (GRCm39) unclassified probably benign
R0058:Helz UTSW 11 107,563,384 (GRCm39) unclassified probably benign
R0112:Helz UTSW 11 107,563,774 (GRCm39) unclassified probably benign
R0243:Helz UTSW 11 107,528,740 (GRCm39) missense possibly damaging 0.85
R0328:Helz UTSW 11 107,495,174 (GRCm39) missense probably benign 0.30
R0578:Helz UTSW 11 107,577,226 (GRCm39) missense unknown
R0928:Helz UTSW 11 107,517,519 (GRCm39) missense probably damaging 0.99
R1428:Helz UTSW 11 107,483,666 (GRCm39) splice site probably benign
R1493:Helz UTSW 11 107,504,751 (GRCm39) missense probably benign 0.15
R1494:Helz UTSW 11 107,494,889 (GRCm39) splice site probably benign
R1541:Helz UTSW 11 107,560,874 (GRCm39) missense probably benign 0.39
R1619:Helz UTSW 11 107,527,105 (GRCm39) nonsense probably null
R1809:Helz UTSW 11 107,489,997 (GRCm39) missense possibly damaging 0.87
R1942:Helz UTSW 11 107,493,318 (GRCm39) missense probably benign 0.20
R2095:Helz UTSW 11 107,536,972 (GRCm39) missense probably damaging 1.00
R2133:Helz UTSW 11 107,561,310 (GRCm39) missense unknown
R2167:Helz UTSW 11 107,563,790 (GRCm39) unclassified probably benign
R2406:Helz UTSW 11 107,577,378 (GRCm39) missense unknown
R2571:Helz UTSW 11 107,504,778 (GRCm39) missense probably benign 0.05
R2858:Helz UTSW 11 107,563,753 (GRCm39) unclassified probably benign
R3927:Helz UTSW 11 107,576,118 (GRCm39) missense unknown
R4449:Helz UTSW 11 107,494,989 (GRCm39) missense probably benign 0.01
R4453:Helz UTSW 11 107,563,455 (GRCm39) nonsense probably null
R4583:Helz UTSW 11 107,536,895 (GRCm39) missense probably damaging 1.00
R4684:Helz UTSW 11 107,539,971 (GRCm39) missense probably damaging 1.00
R4714:Helz UTSW 11 107,517,542 (GRCm39) critical splice donor site probably null
R4875:Helz UTSW 11 107,528,560 (GRCm39) intron probably benign
R4924:Helz UTSW 11 107,493,165 (GRCm39) missense probably damaging 1.00
R4930:Helz UTSW 11 107,510,994 (GRCm39) missense probably damaging 0.99
R5078:Helz UTSW 11 107,546,922 (GRCm39) missense probably damaging 1.00
R5446:Helz UTSW 11 107,523,030 (GRCm39) missense probably damaging 1.00
R5535:Helz UTSW 11 107,536,946 (GRCm39) missense probably damaging 0.98
R5650:Helz UTSW 11 107,485,972 (GRCm39) missense probably null 0.96
R5714:Helz UTSW 11 107,517,347 (GRCm39) splice site probably null
R5784:Helz UTSW 11 107,561,307 (GRCm39) missense unknown
R5998:Helz UTSW 11 107,576,360 (GRCm39) nonsense probably null
R6042:Helz UTSW 11 107,504,946 (GRCm39) critical splice donor site probably null
R6089:Helz UTSW 11 107,485,963 (GRCm39) critical splice acceptor site probably null
R6137:Helz UTSW 11 107,509,886 (GRCm39) missense possibly damaging 0.83
R6373:Helz UTSW 11 107,486,010 (GRCm39) missense probably benign 0.01
R6392:Helz UTSW 11 107,493,167 (GRCm39) missense possibly damaging 0.80
R6618:Helz UTSW 11 107,489,976 (GRCm39) missense probably benign 0.01
R6644:Helz UTSW 11 107,523,087 (GRCm39) missense possibly damaging 0.74
R6811:Helz UTSW 11 107,510,144 (GRCm39) critical splice donor site probably null
R6874:Helz UTSW 11 107,554,460 (GRCm39) missense probably damaging 0.97
R6911:Helz UTSW 11 107,510,051 (GRCm39) missense probably benign 0.01
R7039:Helz UTSW 11 107,510,144 (GRCm39) critical splice donor site probably null
R7061:Helz UTSW 11 107,540,003 (GRCm39) missense possibly damaging 0.83
R7438:Helz UTSW 11 107,552,856 (GRCm39) missense probably damaging 0.98
R7464:Helz UTSW 11 107,527,104 (GRCm39) missense probably damaging 1.00
R7513:Helz UTSW 11 107,546,941 (GRCm39) missense probably damaging 0.99
R7559:Helz UTSW 11 107,491,104 (GRCm39) missense possibly damaging 0.67
R7734:Helz UTSW 11 107,576,248 (GRCm39) missense unknown
R7780:Helz UTSW 11 107,528,689 (GRCm39) missense probably damaging 1.00
R7982:Helz UTSW 11 107,517,456 (GRCm39) missense possibly damaging 0.84
R8024:Helz UTSW 11 107,577,247 (GRCm39) missense unknown
R8181:Helz UTSW 11 107,563,399 (GRCm39) missense unknown
R8346:Helz UTSW 11 107,563,399 (GRCm39) missense unknown
R8807:Helz UTSW 11 107,493,835 (GRCm39) missense probably damaging 1.00
R8821:Helz UTSW 11 107,525,919 (GRCm39) missense probably damaging 0.99
R8891:Helz UTSW 11 107,552,842 (GRCm39) missense probably damaging 0.99
R8909:Helz UTSW 11 107,556,834 (GRCm39) missense possibly damaging 0.94
R8922:Helz UTSW 11 107,539,985 (GRCm39) missense possibly damaging 0.90
R8926:Helz UTSW 11 107,563,509 (GRCm39) missense unknown
R8988:Helz UTSW 11 107,495,079 (GRCm39) missense probably damaging 0.99
R9053:Helz UTSW 11 107,563,761 (GRCm39) missense unknown
R9056:Helz UTSW 11 107,547,019 (GRCm39) missense possibly damaging 0.84
R9099:Helz UTSW 11 107,523,041 (GRCm39) missense probably damaging 1.00
R9122:Helz UTSW 11 107,556,830 (GRCm39) missense probably benign 0.17
R9194:Helz UTSW 11 107,561,113 (GRCm39) nonsense probably null
R9220:Helz UTSW 11 107,560,873 (GRCm39) missense probably benign 0.11
R9223:Helz UTSW 11 107,509,918 (GRCm39) missense probably benign 0.17
R9242:Helz UTSW 11 107,523,153 (GRCm39) missense probably damaging 1.00
R9644:Helz UTSW 11 107,563,687 (GRCm39) missense unknown
R9761:Helz UTSW 11 107,560,874 (GRCm39) nonsense probably null
X0065:Helz UTSW 11 107,561,273 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGACTTGGCTGACAGATGC -3'
(R):5'- GCGCTATGACAGAATACGTTGG -3'

Sequencing Primer
(F):5'- AGATGCTCTGTTCTGCTTCC -3'
(R):5'- GCTATGACAGAATACGTTGGCTTTTC -3'
Posted On 2021-03-08