Incidental Mutation 'R8730:Itgax'
ID 662702
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 068578-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8730 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to A at 127739066 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably null
Transcript: ENSMUST00000033053
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A C 5: 8,208,830 (GRCm39) S200A probably benign Het
Adgrg3 G A 8: 95,766,556 (GRCm39) R409H probably benign Het
Aldh1l2 C T 10: 83,342,506 (GRCm39) V548M possibly damaging Het
Ampd1 T A 3: 102,992,676 (GRCm39) C143* probably null Het
Angpt4 A G 2: 151,771,467 (GRCm39) Q261R probably damaging Het
Ccar1 T C 10: 62,601,191 (GRCm39) K491E probably damaging Het
Cd177 A T 7: 24,457,501 (GRCm39) M180K possibly damaging Het
Dcst2 C T 3: 89,280,553 (GRCm39) R620C probably damaging Het
Dcun1d4 T A 5: 73,688,832 (GRCm39) probably benign Het
Dhrs1 T A 14: 55,980,978 (GRCm39) T103S probably benign Het
Dnah2 A G 11: 69,384,087 (GRCm39) L1043P possibly damaging Het
Eci3 A T 13: 35,144,405 (GRCm39) N19K probably benign Het
Ets1 A T 9: 32,649,614 (GRCm39) D317V probably damaging Het
Fem1c T C 18: 46,638,668 (GRCm39) I445V possibly damaging Het
Gabpb1 T C 2: 126,492,484 (GRCm39) I176M possibly damaging Het
Gm6563 A T 19: 23,653,429 (GRCm39) K73I probably damaging Het
Grap2 A G 15: 80,532,140 (GRCm39) R252G possibly damaging Het
Gsx1 T C 5: 147,126,651 (GRCm39) L158P probably damaging Het
Hand2 T A 8: 57,775,468 (GRCm39) V176E probably benign Het
Hey2 G T 10: 30,718,622 (GRCm39) T8K possibly damaging Het
Igsf3 T C 3: 101,334,532 (GRCm39) I203T probably benign Het
Kcnn2 A G 18: 45,725,139 (GRCm39) I212V possibly damaging Het
Kcnu1 G T 8: 26,403,708 (GRCm39) V740L probably damaging Het
Kcnv1 A G 15: 44,972,797 (GRCm39) I362T probably damaging Het
Klhdc9 C T 1: 171,186,488 (GRCm39) G316D probably damaging Het
Mcmbp T C 7: 128,317,738 (GRCm39) E169G probably damaging Het
Muc20 G T 16: 32,599,490 (GRCm39) H645N probably benign Het
Nrm A G 17: 36,175,423 (GRCm39) T52A probably benign Het
Or13a23-ps1 T C 7: 140,119,197 (GRCm39) S256P unknown Het
Or14c41 A G 7: 86,235,259 (GRCm39) K259E probably benign Het
Or2y3 A T 17: 38,392,925 (GRCm39) *315K probably null Het
Or4c105 T A 2: 88,648,043 (GRCm39) M176K possibly damaging Het
Or4g7 T A 2: 111,309,934 (GRCm39) D268E probably damaging Het
Or51f23 T C 7: 102,453,348 (GRCm39) V221A probably benign Het
Pde11a A T 2: 75,889,334 (GRCm39) N713K probably damaging Het
Pfpl T C 19: 12,405,944 (GRCm39) L65S probably damaging Het
Prox1 A G 1: 189,894,238 (GRCm39) V69A possibly damaging Het
Prss39 A G 1: 34,539,198 (GRCm39) H146R probably damaging Het
Pxt1 A T 17: 29,153,702 (GRCm39) F44I possibly damaging Het
Rbp3 A G 14: 33,677,795 (GRCm39) D581G probably benign Het
Rims2 A G 15: 39,381,239 (GRCm39) T1057A probably benign Het
Robo1 G A 16: 72,786,495 (GRCm39) G836R probably benign Het
Slc34a3 A T 2: 25,122,057 (GRCm39) S155T possibly damaging Het
Slc35d1 T C 4: 103,030,951 (GRCm39) Y308C Het
Slfn9 T C 11: 82,878,194 (GRCm39) I312V possibly damaging Het
St3gal5 T A 6: 72,130,461 (GRCm39) L351Q probably damaging Het
Tanc1 A G 2: 59,601,590 (GRCm39) D157G probably benign Het
Tmprss11g C T 5: 86,638,837 (GRCm39) probably null Het
Tnpo1 A T 13: 98,989,916 (GRCm39) I745N probably benign Het
Uggt1 C A 1: 36,236,624 (GRCm39) probably null Het
Ugt8a G A 3: 125,732,105 (GRCm39) probably benign Het
Urod T C 4: 116,850,729 (GRCm39) probably benign Het
Vmn1r211 A T 13: 23,035,838 (GRCm39) Y276* probably null Het
Vwa3a T A 7: 120,381,910 (GRCm39) S582T probably damaging Het
Zfp869 A T 8: 70,159,177 (GRCm39) C465* probably null Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCCACTTAATCATTTGGACAG -3'
(R):5'- TAGCCTGGACCTACGATGGATG -3'

Sequencing Primer
(F):5'- ATATCAGCGTCCATCACTGAGGG -3'
(R):5'- CCTACGATGGATGGGGAGTGTC -3'
Posted On 2021-03-08