Incidental Mutation 'R8730:Aldh1l2'
ID 662712
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8730 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83487450-83534140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83506642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 548 (V548M)
Ref Sequence ENSEMBL: ENSMUSP00000020497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect possibly damaging
Transcript: ENSMUST00000020497
AA Change: V548M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: V548M

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146640
AA Change: V435M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: V435M

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A C 5: 8,158,830 S200A probably benign Het
Adgrg3 G A 8: 95,039,928 R409H probably benign Het
Ampd1 T A 3: 103,085,360 C143* probably null Het
Angpt4 A G 2: 151,929,547 Q261R probably damaging Het
Ccar1 T C 10: 62,765,412 K491E probably damaging Het
Cd177 A T 7: 24,758,076 M180K possibly damaging Het
Dcst2 C T 3: 89,373,246 R620C probably damaging Het
Dcun1d4 T A 5: 73,531,489 probably benign Het
Dhrs1 T A 14: 55,743,521 T103S probably benign Het
Dnah2 A G 11: 69,493,261 L1043P possibly damaging Het
Eci3 A T 13: 34,960,422 N19K probably benign Het
Ets1 A T 9: 32,738,318 D317V probably damaging Het
Fem1c T C 18: 46,505,601 I445V possibly damaging Het
Gabpb1 T C 2: 126,650,564 I176M possibly damaging Het
Gm6563 A T 19: 23,676,065 K73I probably damaging Het
Grap2 A G 15: 80,647,939 R252G possibly damaging Het
Gsx1 T C 5: 147,189,841 L158P probably damaging Het
Hand2 T A 8: 57,322,433 V176E probably benign Het
Hey2 G T 10: 30,842,626 T8K possibly damaging Het
Igsf3 T C 3: 101,427,216 I203T probably benign Het
Itgax G A 7: 128,139,894 probably null Het
Kcnn2 A G 18: 45,592,072 I212V possibly damaging Het
Kcnu1 G T 8: 25,913,680 V740L probably damaging Het
Kcnv1 A G 15: 45,109,401 I362T probably damaging Het
Klhdc9 C T 1: 171,358,920 G316D probably damaging Het
Mcmbp T C 7: 128,716,014 E169G probably damaging Het
Muc20 G T 16: 32,779,116 H645N probably benign Het
Nrm A G 17: 35,864,531 T52A probably benign Het
Olfr1202 T A 2: 88,817,699 M176K possibly damaging Het
Olfr1288 T A 2: 111,479,589 D268E probably damaging Het
Olfr131 A T 17: 38,082,034 *315K probably null Het
Olfr295 A G 7: 86,586,051 K259E probably benign Het
Olfr537-ps1 T C 7: 140,539,284 S256P unknown Het
Olfr564 T C 7: 102,804,141 V221A probably benign Het
Pde11a A T 2: 76,058,990 N713K probably damaging Het
Pfpl T C 19: 12,428,580 L65S probably damaging Het
Prox1 A G 1: 190,162,041 V69A possibly damaging Het
Prss39 A G 1: 34,500,117 H146R probably damaging Het
Pxt1 A T 17: 28,934,728 F44I possibly damaging Het
Rbp3 A G 14: 33,955,838 D581G probably benign Het
Rims2 A G 15: 39,517,843 T1057A probably benign Het
Robo1 G A 16: 72,989,607 G836R probably benign Het
Slc34a3 A T 2: 25,232,045 S155T possibly damaging Het
Slc35d1 T C 4: 103,173,754 Y308C Het
Slfn9 T C 11: 82,987,368 I312V possibly damaging Het
St3gal5 T A 6: 72,153,477 L351Q probably damaging Het
Tanc1 A G 2: 59,771,246 D157G probably benign Het
Tmprss11g C T 5: 86,490,978 probably null Het
Tnpo1 A T 13: 98,853,408 I745N probably benign Het
Uggt1 C A 1: 36,197,543 probably null Het
Ugt8a G A 3: 125,938,456 probably benign Het
Urod T C 4: 116,993,532 probably benign Het
Vmn1r211 A T 13: 22,851,668 Y276* probably null Het
Vwa3a T A 7: 120,782,687 S582T probably damaging Het
Zfp869 A T 8: 69,706,527 C465* probably null Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83501921 missense probably damaging 1.00
R8884:Aldh1l2 UTSW 10 83508677 missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83506681 missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83506646 missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83495952 nonsense probably null
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGATCTCGAGTTGCTCCTCTC -3'
(R):5'- CCTATACAGGGCTGGCATAC -3'

Sequencing Primer
(F):5'- GGAGATAAGCTGCCATCTCAG -3'
(R):5'- TGGCATACCCAGCTGCTCTG -3'
Posted On 2021-03-08