Mutagenetix > Incidental Mutation

Incidental Mutation 'R8730:Grap2'

662722

Institutional Source

Beutler Lab

Gene Symbol

Grap2

Ensembl Gene

ENSMUSG00000042351

Gene Name

GRB2-related adaptor protein 2

Synonyms

P38, Gads, Grb2-related adaptor downstream of Sch, Mona, Grf40, GRB2L, GrbX, GRAP-2, GrpL, GRID

MMRRC Submission

068578-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R8730 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80456798-80537055 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80532140 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 252 (R252G)

Ref Sequence

ENSEMBL: ENSMUSP00000046532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043149] [ENSMUST00000229980] [ENSMUST00000230856]

AlphaFold

O89100

PDB Structure

Structural Basis for Specific Recognition of an RxxK-containing SLP-76 peptide by the Gads C-terminal SH3 domain [SOLUTION NMR]
MONA/GADS SH3C DOMAIN [X-RAY DIFFRACTION]
Structural Basis for Differential Recognition of Tyrosine Phosphorylated Sites in the Linker for Activation of T cells (LAT) by the Adaptor Protein Gads [X-RAY DIFFRACTION]
Structural Basis for Differential Recognition of Tyrosine Phosphorylated Sites in the Linker for Activation of T cells (LAT) by the Adaptor Protein Gads [X-RAY DIFFRACTION]
Structural Basis for Differential Recognition of Tyrosine Phosphorylated Sites in the Linker for Activation of T cells (LAT) by the Adaptor Protein Gads [X-RAY DIFFRACTION]
MONA/GADS SH3C IN COMPLEX WITH HPK DERIVED PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of the C-terminal SH3 domain of the adaptor protein GADS in complex with SLP-76 motif peptide reveals a unique SH3-SH3 interaction [X-RAY DIFFRACTION]
MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043149
AA Change: R252G

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046532
Gene: ENSMUSG00000042351
AA Change: R252G

Domain	Start	End	E-Value	Type
SH3	1	55	3.48e-16	SMART
SH2	56	138	7.49e-32	SMART
low complexity region	193	216	N/A	INTRINSIC
SH3	266	321	4.31e-21	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229980
AA Change: R252G

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000230856

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.3%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly healthy but display abnormal T cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	A	C	5: 8,208,830 (GRCm39)	S200A	probably benign	Het
Adgrg3	G	A	8: 95,766,556 (GRCm39)	R409H	probably benign	Het
Aldh1l2	C	T	10: 83,342,506 (GRCm39)	V548M	possibly damaging	Het
Ampd1	T	A	3: 102,992,676 (GRCm39)	C143*	probably null	Het
Angpt4	A	G	2: 151,771,467 (GRCm39)	Q261R	probably damaging	Het
Ccar1	T	C	10: 62,601,191 (GRCm39)	K491E	probably damaging	Het
Cd177	A	T	7: 24,457,501 (GRCm39)	M180K	possibly damaging	Het
Dcst2	C	T	3: 89,280,553 (GRCm39)	R620C	probably damaging	Het
Dcun1d4	T	A	5: 73,688,832 (GRCm39)		probably benign	Het
Dhrs1	T	A	14: 55,980,978 (GRCm39)	T103S	probably benign	Het
Dnah2	A	G	11: 69,384,087 (GRCm39)	L1043P	possibly damaging	Het
Eci3	A	T	13: 35,144,405 (GRCm39)	N19K	probably benign	Het
Ets1	A	T	9: 32,649,614 (GRCm39)	D317V	probably damaging	Het
Fem1c	T	C	18: 46,638,668 (GRCm39)	I445V	possibly damaging	Het
Gabpb1	T	C	2: 126,492,484 (GRCm39)	I176M	possibly damaging	Het
Gm6563	A	T	19: 23,653,429 (GRCm39)	K73I	probably damaging	Het
Gsx1	T	C	5: 147,126,651 (GRCm39)	L158P	probably damaging	Het
Hand2	T	A	8: 57,775,468 (GRCm39)	V176E	probably benign	Het
Hey2	G	T	10: 30,718,622 (GRCm39)	T8K	possibly damaging	Het
Igsf3	T	C	3: 101,334,532 (GRCm39)	I203T	probably benign	Het
Itgax	G	A	7: 127,739,066 (GRCm39)		probably null	Het
Kcnn2	A	G	18: 45,725,139 (GRCm39)	I212V	possibly damaging	Het
Kcnu1	G	T	8: 26,403,708 (GRCm39)	V740L	probably damaging	Het
Kcnv1	A	G	15: 44,972,797 (GRCm39)	I362T	probably damaging	Het
Klhdc9	C	T	1: 171,186,488 (GRCm39)	G316D	probably damaging	Het
Mcmbp	T	C	7: 128,317,738 (GRCm39)	E169G	probably damaging	Het
Muc20	G	T	16: 32,599,490 (GRCm39)	H645N	probably benign	Het
Nrm	A	G	17: 36,175,423 (GRCm39)	T52A	probably benign	Het
Or13a23-ps1	T	C	7: 140,119,197 (GRCm39)	S256P	unknown	Het
Or14c41	A	G	7: 86,235,259 (GRCm39)	K259E	probably benign	Het
Or2y3	A	T	17: 38,392,925 (GRCm39)	*315K	probably null	Het
Or4c105	T	A	2: 88,648,043 (GRCm39)	M176K	possibly damaging	Het
Or4g7	T	A	2: 111,309,934 (GRCm39)	D268E	probably damaging	Het
Or51f23	T	C	7: 102,453,348 (GRCm39)	V221A	probably benign	Het
Pde11a	A	T	2: 75,889,334 (GRCm39)	N713K	probably damaging	Het
Pfpl	T	C	19: 12,405,944 (GRCm39)	L65S	probably damaging	Het
Prox1	A	G	1: 189,894,238 (GRCm39)	V69A	possibly damaging	Het
Prss39	A	G	1: 34,539,198 (GRCm39)	H146R	probably damaging	Het
Pxt1	A	T	17: 29,153,702 (GRCm39)	F44I	possibly damaging	Het
Rbp3	A	G	14: 33,677,795 (GRCm39)	D581G	probably benign	Het
Rims2	A	G	15: 39,381,239 (GRCm39)	T1057A	probably benign	Het
Robo1	G	A	16: 72,786,495 (GRCm39)	G836R	probably benign	Het
Slc34a3	A	T	2: 25,122,057 (GRCm39)	S155T	possibly damaging	Het
Slc35d1	T	C	4: 103,030,951 (GRCm39)	Y308C		Het
Slfn9	T	C	11: 82,878,194 (GRCm39)	I312V	possibly damaging	Het
St3gal5	T	A	6: 72,130,461 (GRCm39)	L351Q	probably damaging	Het
Tanc1	A	G	2: 59,601,590 (GRCm39)	D157G	probably benign	Het
Tmprss11g	C	T	5: 86,638,837 (GRCm39)		probably null	Het
Tnpo1	A	T	13: 98,989,916 (GRCm39)	I745N	probably benign	Het
Uggt1	C	A	1: 36,236,624 (GRCm39)		probably null	Het
Ugt8a	G	A	3: 125,732,105 (GRCm39)		probably benign	Het
Urod	T	C	4: 116,850,729 (GRCm39)		probably benign	Het
Vmn1r211	A	T	13: 23,035,838 (GRCm39)	Y276*	probably null	Het
Vwa3a	T	A	7: 120,381,910 (GRCm39)	S582T	probably damaging	Het
Zfp869	A	T	8: 70,159,177 (GRCm39)	C465*	probably null	Het

Other mutations in Grap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01727:Grap2	APN	15	80,518,610 (GRCm39)	missense	probably damaging	1.00
IGL02121:Grap2	APN	15	80,532,076 (GRCm39)	missense	possibly damaging	0.77
IGL02347:Grap2	APN	15	80,530,557 (GRCm39)	splice site	probably benign
IGL02561:Grap2	APN	15	80,532,049 (GRCm39)	splice site	probably benign
Aquavit	UTSW	15	80,527,874 (GRCm39)	missense	probably damaging	0.97
Grappa	UTSW	15	80,532,723 (GRCm39)	missense	probably damaging	0.98
R1465:Grap2	UTSW	15	80,532,612 (GRCm39)	splice site	probably null
R1465:Grap2	UTSW	15	80,532,612 (GRCm39)	splice site	probably null
R1591:Grap2	UTSW	15	80,532,649 (GRCm39)	missense	probably damaging	1.00
R2050:Grap2	UTSW	15	80,530,444 (GRCm39)	missense	probably benign	0.09
R2862:Grap2	UTSW	15	80,532,165 (GRCm39)	missense	probably damaging	0.98
R3801:Grap2	UTSW	15	80,507,947 (GRCm39)	missense	possibly damaging	0.62
R3804:Grap2	UTSW	15	80,507,947 (GRCm39)	missense	possibly damaging	0.62
R4838:Grap2	UTSW	15	80,522,762 (GRCm39)	missense	possibly damaging	0.92
R5090:Grap2	UTSW	15	80,522,683 (GRCm39)	missense	possibly damaging	0.95
R5119:Grap2	UTSW	15	80,530,345 (GRCm39)	missense	possibly damaging	0.93
R5121:Grap2	UTSW	15	80,530,345 (GRCm39)	missense	possibly damaging	0.93
R6652:Grap2	UTSW	15	80,532,723 (GRCm39)	missense	probably damaging	0.98
R6873:Grap2	UTSW	15	80,527,874 (GRCm39)	missense	probably damaging	0.97
R7082:Grap2	UTSW	15	80,532,699 (GRCm39)	missense	probably benign	0.27
R7512:Grap2	UTSW	15	80,532,754 (GRCm39)	missense	probably benign	0.08
R7571:Grap2	UTSW	15	80,527,905 (GRCm39)	missense	probably damaging	1.00
R8833:Grap2	UTSW	15	80,522,684 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GATGATGGCCAGCAAGTCTTC -3'
(R):5'- ACGTGTACTGGATCGCAAG -3'

Sequencing Primer
(F):5'- GGTGTTATCTCAGTAGACAGCACC -3'
(R):5'- TGTACTGGATCGCAAGGATAAACC -3'

Posted On

2021-03-08