Incidental Mutation 'R8731:Fam227b'
ID662738
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8731 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126126978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 59 (Y59N)
Ref Sequence ENSEMBL: ENSMUSP00000106076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110446
AA Change: Y59N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: Y59N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110448
AA Change: Y59N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: Y59N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178118
AA Change: Y59N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: Y59N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 60,024,946 D294V probably benign Het
Abcc8 T G 7: 46,154,562 Y396S probably damaging Het
Ace T A 11: 105,970,600 F192I possibly damaging Het
Apeh A G 9: 108,087,223 S494P probably benign Het
Bod1 A G 11: 31,669,242 probably null Het
Cap2 T C 13: 46,646,530 M404T probably benign Het
Cc2d2a A T 5: 43,735,446 D1450V probably damaging Het
Ccdc144b A T 3: 36,035,285 N163K probably benign Het
Clip1 A C 5: 123,614,693 S342A Het
Cox10 A G 11: 63,964,219 F412S probably damaging Het
Cracr2a T G 6: 127,625,927 probably null Het
Dcaf7 T A 11: 106,054,722 M299K possibly damaging Het
Dffb T C 4: 153,974,644 T59A possibly damaging Het
Dgkd A G 1: 87,916,813 M234V possibly damaging Het
Disp1 A T 1: 183,087,508 V1116E possibly damaging Het
Dpysl3 C T 18: 43,438,092 C39Y probably damaging Het
Dync1h1 T A 12: 110,640,584 V2565D possibly damaging Het
Gm21680 A T 5: 25,968,232 V210D probably damaging Het
Gnas T C 2: 174,284,906 V78A probably benign Het
Gpr179 T C 11: 97,343,729 T509A probably damaging Het
Igfn1 A G 1: 135,997,836 M60T probably benign Het
Llgl2 A G 11: 115,851,190 Q686R probably benign Het
Muc4 G C 16: 32,754,427 A1434P probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk3 T G 8: 85,359,005 E300A probably benign Het
Myo9b T C 8: 71,353,842 probably null Het
Nalcn T C 14: 123,599,854 I33V probably benign Het
Nsl1 A G 1: 191,082,412 Y270C probably damaging Het
Olfr312 C T 11: 58,831,442 A96V probably benign Het
Otulin A G 15: 27,608,842 M205T probably benign Het
Plch1 A T 3: 63,697,638 V1615E probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn3a A T 2: 65,468,163 Y1397* probably null Het
Scrib A T 15: 76,063,639 H549Q probably benign Het
Slc36a4 A G 9: 15,719,752 I56V possibly damaging Het
Spata7 T A 12: 98,658,282 S148T probably damaging Het
Stk31 T A 6: 49,438,501 L590Q probably benign Het
Tanc1 T C 2: 59,843,252 V1567A probably benign Het
Tspan33 T C 6: 29,717,311 F237S probably damaging Het
Uhrf1 T A 17: 56,322,363 L737Q probably damaging Het
Vmn2r2 A G 3: 64,116,983 F726L probably benign Het
Vmn2r65 A T 7: 84,940,239 L823* probably null Het
Vps11 T C 9: 44,354,459 N508D probably benign Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
R8417:Fam227b UTSW 2 126121062 missense probably damaging 1.00
R8679:Fam227b UTSW 2 125989008 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTATGAGAATACACATAGAGCAAGC -3'
(R):5'- GGTCCCCTAAGGCTTTTGATTATTC -3'

Sequencing Primer
(F):5'- TAGAGCAAGCATACATAGACAGAC -3'
(R):5'- GATTATTGGCCCAGGGAT -3'
Posted On2021-03-08