Incidental Mutation 'R8731:Ace'
ID 662764
Institutional Source Beutler Lab
Gene Symbol Ace
Ensembl Gene ENSMUSG00000020681
Gene Name angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Synonyms CD143
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8731 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 105967945-105989964 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105970600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 192 (F192I)
Ref Sequence ENSEMBL: ENSMUSP00000001963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]
AlphaFold P09470
Predicted Effect possibly damaging
Transcript: ENSMUST00000001963
AA Change: F192I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: F192I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Peptidase_M2 45 628 7.1e-257 PFAM
Pfam:Peptidase_M2 648 1226 8.9e-261 PFAM
transmembrane domain 1264 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001964
SMART Domains Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_M2 59 653 N/A PFAM
transmembrane domain 684 706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132280
SMART Domains Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681

DomainStartEndE-ValueType
Pfam:Peptidase_M2 1 395 2.4e-201 PFAM
Pfam:Peptidase_M2 415 993 1.4e-261 PFAM
low complexity region 999 1014 N/A INTRINSIC
Meta Mutation Damage Score 0.3589 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 95.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 60,024,946 D294V probably benign Het
Abcc8 T G 7: 46,154,562 Y396S probably damaging Het
Apeh A G 9: 108,087,223 S494P probably benign Het
Bod1 A G 11: 31,669,242 probably null Het
Cap2 T C 13: 46,646,530 M404T probably benign Het
Cc2d2a A T 5: 43,735,446 D1450V probably damaging Het
Ccdc144b A T 3: 36,035,285 N163K probably benign Het
Cdk5rap2 A T 4: 70,245,510 probably benign Het
Clip1 A C 5: 123,614,693 S342A Het
Cox10 A G 11: 63,964,219 F412S probably damaging Het
Cracr2a T G 6: 127,625,927 probably null Het
Dcaf7 T A 11: 106,054,722 M299K possibly damaging Het
Dffb T C 4: 153,974,644 T59A possibly damaging Het
Dgkd A G 1: 87,916,813 M234V possibly damaging Het
Disp1 A T 1: 183,087,508 V1116E possibly damaging Het
Dpysl3 C T 18: 43,438,092 C39Y probably damaging Het
Dync1h1 T A 12: 110,640,584 V2565D possibly damaging Het
Fam227b A T 2: 126,126,978 Y59N possibly damaging Het
Gm21680 A T 5: 25,968,232 V210D probably damaging Het
Gnas T C 2: 174,284,906 V78A probably benign Het
Gpr179 T C 11: 97,343,729 T509A probably damaging Het
Igfn1 A G 1: 135,997,836 M60T probably benign Het
Llgl2 A G 11: 115,851,190 Q686R probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk3 T G 8: 85,359,005 E300A probably benign Het
Myo1b A C 1: 51,760,411 probably benign Het
Myo9b T C 8: 71,353,842 probably null Het
Nalcn T C 14: 123,599,854 I33V probably benign Het
Nsl1 A G 1: 191,082,412 Y270C probably damaging Het
Olfr312 C T 11: 58,831,442 A96V probably benign Het
Otulin A G 15: 27,608,842 M205T probably benign Het
Plch1 A T 3: 63,697,638 V1615E probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn3a A T 2: 65,468,163 Y1397* probably null Het
Scrib A T 15: 76,063,639 H549Q probably benign Het
Slc36a4 A G 9: 15,719,752 I56V possibly damaging Het
Spata7 T A 12: 98,658,282 S148T probably damaging Het
Stk31 T A 6: 49,438,501 L590Q probably benign Het
Tanc1 T C 2: 59,843,252 V1567A probably benign Het
Tspan33 T C 6: 29,717,311 F237S probably damaging Het
Uhrf1 T A 17: 56,322,363 L737Q probably damaging Het
Vmn2r2 A G 3: 64,116,983 F726L probably benign Het
Vmn2r65 A T 7: 84,940,239 L823* probably null Het
Vps11 T C 9: 44,354,459 N508D probably benign Het
Other mutations in Ace
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ace APN 11 105979550 missense probably benign 0.21
IGL01105:Ace APN 11 105972059 missense probably damaging 1.00
IGL01761:Ace APN 11 105979493 missense possibly damaging 0.70
IGL01888:Ace APN 11 105968944 missense probably benign
IGL02173:Ace APN 11 105988991 missense probably benign 0.04
IGL02179:Ace APN 11 105969789 missense probably benign 0.16
IGL02331:Ace APN 11 105971344 missense possibly damaging 0.61
IGL02333:Ace APN 11 105971447 missense probably benign
IGL02556:Ace APN 11 105972527 missense probably damaging 1.00
IGL02576:Ace APN 11 105974111 missense probably damaging 1.00
IGL03202:Ace APN 11 105976962 missense probably damaging 1.00
R0403:Ace UTSW 11 105973880 splice site probably null
R0709:Ace UTSW 11 105981538 missense probably damaging 0.97
R1555:Ace UTSW 11 105974901 splice site probably null
R1603:Ace UTSW 11 105972099 missense probably benign 0.23
R1644:Ace UTSW 11 105985106 missense probably damaging 1.00
R1834:Ace UTSW 11 105986094 splice site probably benign
R2074:Ace UTSW 11 105976623 nonsense probably null
R3025:Ace UTSW 11 105974093 splice site probably null
R3176:Ace UTSW 11 105976702 missense probably null 1.00
R3276:Ace UTSW 11 105976702 missense probably null 1.00
R3977:Ace UTSW 11 105981838 missense possibly damaging 0.96
R4506:Ace UTSW 11 105976666 missense probably damaging 0.98
R4598:Ace UTSW 11 105981759 splice site probably null
R4914:Ace UTSW 11 105979597 missense probably damaging 1.00
R4968:Ace UTSW 11 105981853 missense possibly damaging 0.93
R5137:Ace UTSW 11 105974826 missense probably damaging 1.00
R5274:Ace UTSW 11 105968037 missense probably benign
R5332:Ace UTSW 11 105973879 critical splice donor site probably null
R5388:Ace UTSW 11 105988458 missense possibly damaging 0.85
R5425:Ace UTSW 11 105973428 missense probably damaging 1.00
R5640:Ace UTSW 11 105970685 missense probably damaging 1.00
R5838:Ace UTSW 11 105972880 missense probably benign 0.00
R6041:Ace UTSW 11 105975308 missense probably benign 0.27
R6083:Ace UTSW 11 105985267 nonsense probably null
R6106:Ace UTSW 11 105989012 missense probably damaging 1.00
R6225:Ace UTSW 11 105979619 missense possibly damaging 0.51
R6607:Ace UTSW 11 105972377 missense possibly damaging 0.82
R6918:Ace UTSW 11 105972943 missense probably damaging 1.00
R7330:Ace UTSW 11 105986061 missense probably damaging 1.00
R7471:Ace UTSW 11 105973482 missense probably damaging 1.00
R7709:Ace UTSW 11 105988837 missense probably benign 0.01
R7800:Ace UTSW 11 105986058 missense probably damaging 1.00
R7855:Ace UTSW 11 105972379 missense probably benign 0.05
R7947:Ace UTSW 11 105973054 missense possibly damaging 0.81
R8063:Ace UTSW 11 105971364 missense possibly damaging 0.90
R8072:Ace UTSW 11 105972959 missense probably damaging 0.98
R8412:Ace UTSW 11 105979266 missense probably benign
R8544:Ace UTSW 11 105971290 critical splice acceptor site probably null
R8695:Ace UTSW 11 105985145 missense probably benign 0.00
R8855:Ace UTSW 11 105970598 nonsense probably null
R9087:Ace UTSW 11 105981919 missense probably damaging 1.00
R9149:Ace UTSW 11 105972473 missense possibly damaging 0.57
R9347:Ace UTSW 11 105974132 missense probably damaging 1.00
R9590:Ace UTSW 11 105985680 missense probably benign 0.01
X0018:Ace UTSW 11 105971384 missense probably damaging 1.00
X0063:Ace UTSW 11 105975638 missense probably benign 0.07
Z1177:Ace UTSW 11 105988134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGACGTTTTCCTGGGAGC -3'
(R):5'- ATCTAGCTCAGGGGTTTAGGGC -3'

Sequencing Primer
(F):5'- TTTCCTGGGAGCAGGGTCC -3'
(R):5'- TTAGGGCTCACTGGGGAC -3'
Posted On 2021-03-08