Incidental Mutation 'R8731:Llgl2'
ID662766
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R8731 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115851190 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 686 (Q686R)
Ref Sequence ENSEMBL: ENSMUSP00000136054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000177736]
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128826
Predicted Effect probably benign
Transcript: ENSMUST00000177736
AA Change: Q686R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: Q686R

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 95.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 60,024,946 D294V probably benign Het
Abcc8 T G 7: 46,154,562 Y396S probably damaging Het
Ace T A 11: 105,970,600 F192I possibly damaging Het
Apeh A G 9: 108,087,223 S494P probably benign Het
Bod1 A G 11: 31,669,242 probably null Het
Cap2 T C 13: 46,646,530 M404T probably benign Het
Cc2d2a A T 5: 43,735,446 D1450V probably damaging Het
Ccdc144b A T 3: 36,035,285 N163K probably benign Het
Cdk5rap2 A T 4: 70,245,510 probably benign Het
Clip1 A C 5: 123,614,693 S342A Het
Cox10 A G 11: 63,964,219 F412S probably damaging Het
Cracr2a T G 6: 127,625,927 probably null Het
Dcaf7 T A 11: 106,054,722 M299K possibly damaging Het
Dffb T C 4: 153,974,644 T59A possibly damaging Het
Dgkd A G 1: 87,916,813 M234V possibly damaging Het
Disp1 A T 1: 183,087,508 V1116E possibly damaging Het
Dpysl3 C T 18: 43,438,092 C39Y probably damaging Het
Dync1h1 T A 12: 110,640,584 V2565D possibly damaging Het
Fam227b A T 2: 126,126,978 Y59N possibly damaging Het
Gm21680 A T 5: 25,968,232 V210D probably damaging Het
Gnas T C 2: 174,284,906 V78A probably benign Het
Gpr179 T C 11: 97,343,729 T509A probably damaging Het
Igfn1 A G 1: 135,997,836 M60T probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk3 T G 8: 85,359,005 E300A probably benign Het
Myo1b A C 1: 51,760,411 probably benign Het
Myo9b T C 8: 71,353,842 probably null Het
Nalcn T C 14: 123,599,854 I33V probably benign Het
Nsl1 A G 1: 191,082,412 Y270C probably damaging Het
Olfr312 C T 11: 58,831,442 A96V probably benign Het
Otulin A G 15: 27,608,842 M205T probably benign Het
Plch1 A T 3: 63,697,638 V1615E probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn3a A T 2: 65,468,163 Y1397* probably null Het
Scrib A T 15: 76,063,639 H549Q probably benign Het
Slc36a4 A G 9: 15,719,752 I56V possibly damaging Het
Spata7 T A 12: 98,658,282 S148T probably damaging Het
Stk31 T A 6: 49,438,501 L590Q probably benign Het
Tanc1 T C 2: 59,843,252 V1567A probably benign Het
Tspan33 T C 6: 29,717,311 F237S probably damaging Het
Uhrf1 T A 17: 56,322,363 L737Q probably damaging Het
Vmn2r2 A G 3: 64,116,983 F726L probably benign Het
Vmn2r65 A T 7: 84,940,239 L823* probably null Het
Vps11 T C 9: 44,354,459 N508D probably benign Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0345:Llgl2 UTSW 11 115849992 splice site probably benign
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1387:Llgl2 UTSW 11 115853132 missense probably damaging 0.99
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R4907:Llgl2 UTSW 11 115853974 nonsense probably null
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6804:Llgl2 UTSW 11 115843315 critical splice acceptor site probably null
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
R7324:Llgl2 UTSW 11 115850730 missense possibly damaging 0.49
R7332:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R7715:Llgl2 UTSW 11 115849728 missense probably benign
R8038:Llgl2 UTSW 11 115851103 missense probably benign 0.17
R8069:Llgl2 UTSW 11 115853286 missense probably damaging 0.99
R8076:Llgl2 UTSW 11 115846929 missense possibly damaging 0.69
R8109:Llgl2 UTSW 11 115850793 missense possibly damaging 0.52
R8129:Llgl2 UTSW 11 115850911 splice site probably null
R8881:Llgl2 UTSW 11 115853040 missense probably benign 0.02
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Z1176:Llgl2 UTSW 11 115849554 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTCCACTTCCTCAAGGTGC -3'
(R):5'- TCAGCAACAGTGACCTGACTC -3'

Sequencing Primer
(F):5'- GTGCACACTTCACCCCAGTG -3'
(R):5'- CTCAGACAACAACTGTGCATATTTGC -3'
Posted On2021-03-08