Incidental Mutation 'R8732:Prdm2'
ID662792
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8732 (G1)
Quality Score158.009
Status Not validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 143136010 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 237 (Q237K)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably benign
Transcript: ENSMUST00000105778
AA Change: Q237K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Q237K

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,828,146 N82K probably damaging Het
Ankrd36 T A 11: 5,628,906 S57T possibly damaging Het
Aoc3 A G 11: 101,331,817 N293S probably benign Het
Aup1 A T 6: 83,056,621 H302L probably damaging Het
Bptf G A 11: 107,040,380 R277W probably damaging Het
Cald1 A G 6: 34,758,011 I346V unknown Het
Cd44 T C 2: 102,834,300 T519A possibly damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Ces2g T C 8: 104,962,563 V57A possibly damaging Het
Cpt1b G C 15: 89,424,425 T100S probably benign Het
D6Wsu163e A T 6: 126,955,896 I361F possibly damaging Het
Dock5 A T 14: 67,846,000 D153E possibly damaging Het
Dync2h1 G T 9: 7,168,326 R430S probably damaging Het
Eml5 C T 12: 98,815,959 G1405R probably damaging Het
Ergic2 G A 6: 148,201,477 A91V probably damaging Het
Fancl A T 11: 26,469,754 I336L probably benign Het
Fpr3 A G 17: 17,970,961 T165A possibly damaging Het
Gm11639 T A 11: 104,804,274 F1730L probably benign Het
Gon4l A G 3: 88,899,984 I1662V possibly damaging Het
Gpr153 C T 4: 152,279,101 probably benign Het
Hdac4 C A 1: 91,947,517 A911S probably damaging Het
Ighd T C 12: 113,414,563 N139D Het
Klhl22 T A 16: 17,771,826 L117Q probably damaging Het
Kntc1 A G 5: 123,790,117 S1226G probably benign Het
Lama5 A T 2: 180,186,688 C2126S probably damaging Het
Ldlr A G 9: 21,739,689 I468V probably benign Het
Lmtk3 G A 7: 45,798,288 A1253T unknown Het
Lta T A 17: 35,204,069 N93Y probably damaging Het
Macf1 A T 4: 123,509,770 probably null Het
Mink1 A G 11: 70,610,076 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ntpcr A G 8: 125,745,335 M132V probably benign Het
Olfr298 A G 7: 86,488,853 S233P probably damaging Het
Olfr851 T C 9: 19,496,802 I18T probably benign Het
Padi2 A G 4: 140,933,279 I357V probably benign Het
Pax7 G T 4: 139,779,609 H372Q probably benign Het
Paxip1 A G 5: 27,744,543 Y966H probably damaging Het
Pde4b A C 4: 102,555,625 D199A probably null Het
Pkd1l2 T C 8: 117,065,572 N494D probably benign Het
Prune2 T C 19: 17,120,405 L1091P probably damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Rassf5 A G 1: 131,178,527 *414Q probably null Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rrp9 C A 9: 106,483,189 T238K probably benign Het
Slc44a2 A G 9: 21,348,586 D630G probably benign Het
Slc7a9 A G 7: 35,457,018 D295G probably benign Het
Slco3a1 A T 7: 74,284,306 M706K possibly damaging Het
Spag9 T C 11: 94,071,688 probably null Het
Stam2 A T 2: 52,700,168 Y394N probably damaging Het
Stard9 T C 2: 120,679,961 L341P probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Stxbp5l A T 16: 37,241,447 C334S probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,707,136 K34816R possibly damaging Het
Ttn T A 2: 76,797,391 N14736I probably damaging Het
Vmn1r183 A G 7: 24,055,465 Q231R possibly damaging Het
Vmn1r235 A G 17: 21,262,177 T255A probably damaging Het
Wasl A T 6: 24,619,210 I437K unknown Het
Wdr34 T A 2: 30,032,208 T414S possibly damaging Het
Ywhae A G 11: 75,751,943 N43D probably damaging Het
Zfp583 A T 7: 6,317,211 Y267* probably null Het
Zfp608 C T 18: 54,988,000 G172R probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
G1patch:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8688:Prdm2 UTSW 4 143111740 missense probably benign
R8796:Prdm2 UTSW 4 143133447 missense probably benign 0.33
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTTTCATTCGGCATGTCTG -3'
(R):5'- GATTTGCACCCAGCTCAAC -3'

Sequencing Primer
(F):5'- GCATGTCTGCTTCTTCCTCC -3'
(R):5'- GTTCACATATCTTAGCAGCTTCTAG -3'
Posted On2021-03-08