Mutagenetix > Incidental Mutations

Incidental Mutation 'R8732:Prdm2'

662792

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8732 (G1)

Quality Score

158.009

Status

Not validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 143136010 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 237 (Q237K)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: Q237K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Q237K

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adtrp	A	T	13: 41,828,146	N82K	probably damaging	Het
Ankrd36	T	A	11: 5,628,906	S57T	possibly damaging	Het
Aoc3	A	G	11: 101,331,817	N293S	probably benign	Het
Aup1	A	T	6: 83,056,621	H302L	probably damaging	Het
Bptf	G	A	11: 107,040,380	R277W	probably damaging	Het
Cald1	A	G	6: 34,758,011	I346V	unknown	Het
Cd44	T	C	2: 102,834,300	T519A	possibly damaging	Het
Cela1	A	G	15: 100,682,885		probably null	Het
Ces2g	T	C	8: 104,962,563	V57A	possibly damaging	Het
Cpt1b	G	C	15: 89,424,425	T100S	probably benign	Het
D6Wsu163e	A	T	6: 126,955,896	I361F	possibly damaging	Het
Dock5	A	T	14: 67,846,000	D153E	possibly damaging	Het
Dync2h1	G	T	9: 7,168,326	R430S	probably damaging	Het
Eml5	C	T	12: 98,815,959	G1405R	probably damaging	Het
Ergic2	G	A	6: 148,201,477	A91V	probably damaging	Het
Fancl	A	T	11: 26,469,754	I336L	probably benign	Het
Fpr3	A	G	17: 17,970,961	T165A	possibly damaging	Het
Gm11639	T	A	11: 104,804,274	F1730L	probably benign	Het
Gon4l	A	G	3: 88,899,984	I1662V	possibly damaging	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Hdac4	C	A	1: 91,947,517	A911S	probably damaging	Het
Ighd	T	C	12: 113,414,563	N139D		Het
Klhl22	T	A	16: 17,771,826	L117Q	probably damaging	Het
Kntc1	A	G	5: 123,790,117	S1226G	probably benign	Het
Lama5	A	T	2: 180,186,688	C2126S	probably damaging	Het
Ldlr	A	G	9: 21,739,689	I468V	probably benign	Het
Lmtk3	G	A	7: 45,798,288	A1253T	unknown	Het
Lta	T	A	17: 35,204,069	N93Y	probably damaging	Het
Macf1	A	T	4: 123,509,770		probably null	Het
Mink1	A	G	11: 70,610,076		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Ntpcr	A	G	8: 125,745,335	M132V	probably benign	Het
Olfr298	A	G	7: 86,488,853	S233P	probably damaging	Het
Olfr851	T	C	9: 19,496,802	I18T	probably benign	Het
Padi2	A	G	4: 140,933,279	I357V	probably benign	Het
Pax7	G	T	4: 139,779,609	H372Q	probably benign	Het
Paxip1	A	G	5: 27,744,543	Y966H	probably damaging	Het
Pde4b	A	C	4: 102,555,625	D199A	probably null	Het
Pkd1l2	T	C	8: 117,065,572	N494D	probably benign	Het
Prune2	T	C	19: 17,120,405	L1091P	probably damaging	Het
Rab9	C	T	X: 166,457,758	D186N	probably benign	Het
Rassf5	A	G	1: 131,178,527	*414Q	probably null	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rrp9	C	A	9: 106,483,189	T238K	probably benign	Het
Slc44a2	A	G	9: 21,348,586	D630G	probably benign	Het
Slc7a9	A	G	7: 35,457,018	D295G	probably benign	Het
Slco3a1	A	T	7: 74,284,306	M706K	possibly damaging	Het
Spag9	T	C	11: 94,071,688		probably null	Het
Stam2	A	T	2: 52,700,168	Y394N	probably damaging	Het
Stard9	T	C	2: 120,679,961	L341P	probably damaging	Het
Steap3	A	T	1: 120,243,894	H160Q	probably damaging	Het
Stxbp5l	A	T	16: 37,241,447	C334S	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Ttn	T	C	2: 76,707,136	K34816R	possibly damaging	Het
Ttn	T	A	2: 76,797,391	N14736I	probably damaging	Het
Vmn1r183	A	G	7: 24,055,465	Q231R	possibly damaging	Het
Vmn1r235	A	G	17: 21,262,177	T255A	probably damaging	Het
Wasl	A	T	6: 24,619,210	I437K	unknown	Het
Wdr34	T	A	2: 30,032,208	T414S	possibly damaging	Het
Ywhae	A	G	11: 75,751,943	N43D	probably damaging	Het
Zfp583	A	T	7: 6,317,211	Y267*	probably null	Het
Zfp608	C	T	18: 54,988,000	G172R	probably benign	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGCTTTCATTCGGCATGTCTG -3'
(R):5'- GATTTGCACCCAGCTCAAC -3'

Sequencing Primer
(F):5'- GCATGTCTGCTTCTTCCTCC -3'
(R):5'- GTTCACATATCTTAGCAGCTTCTAG -3'

Posted On

2021-03-08