Incidental Mutation 'R8732:Paxip1'
ID 662794
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene Name PAX interacting (with transcription-activation domain) protein 1
Synonyms D5Ertd149e, PTIP
MMRRC Submission 068580-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8732 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 27945078-27996689 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27949541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 966 (Y966H)
Ref Sequence ENSEMBL: ENSMUSP00000002291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291]
AlphaFold Q6NZQ4
Predicted Effect probably damaging
Transcript: ENSMUST00000002291
AA Change: Y966H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: Y966H

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Meta Mutation Damage Score 0.1290 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,981,622 (GRCm39) N82K probably damaging Het
Ankrd36 T A 11: 5,578,906 (GRCm39) S57T possibly damaging Het
Aoc3 A G 11: 101,222,643 (GRCm39) N293S probably benign Het
Aup1 A T 6: 83,033,602 (GRCm39) H302L probably damaging Het
Bptf G A 11: 106,931,206 (GRCm39) R277W probably damaging Het
Cald1 A G 6: 34,734,946 (GRCm39) I346V unknown Het
Cd44 T C 2: 102,664,645 (GRCm39) T519A possibly damaging Het
Cela1 A G 15: 100,580,766 (GRCm39) probably null Het
Ces2g T C 8: 105,689,195 (GRCm39) V57A possibly damaging Het
Cpt1b G C 15: 89,308,628 (GRCm39) T100S probably benign Het
D6Wsu163e A T 6: 126,932,859 (GRCm39) I361F possibly damaging Het
Dock5 A T 14: 68,083,449 (GRCm39) D153E possibly damaging Het
Dync2h1 G T 9: 7,168,326 (GRCm39) R430S probably damaging Het
Dync2i2 T A 2: 29,922,220 (GRCm39) T414S possibly damaging Het
Efcab3 T A 11: 104,695,100 (GRCm39) F1730L probably benign Het
Eml5 C T 12: 98,782,218 (GRCm39) G1405R probably damaging Het
Ergic2 G A 6: 148,102,975 (GRCm39) A91V probably damaging Het
Fancl A T 11: 26,419,754 (GRCm39) I336L probably benign Het
Fpr3 A G 17: 18,191,223 (GRCm39) T165A possibly damaging Het
Gon4l A G 3: 88,807,291 (GRCm39) I1662V possibly damaging Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Hdac4 C A 1: 91,875,239 (GRCm39) A911S probably damaging Het
Ighd T C 12: 113,378,183 (GRCm39) N139D Het
Klhl22 T A 16: 17,589,690 (GRCm39) L117Q probably damaging Het
Kntc1 A G 5: 123,928,180 (GRCm39) S1226G probably benign Het
Lama5 A T 2: 179,828,481 (GRCm39) C2126S probably damaging Het
Ldlr A G 9: 21,650,985 (GRCm39) I468V probably benign Het
Lmtk3 G A 7: 45,447,712 (GRCm39) A1253T unknown Het
Lta T A 17: 35,423,045 (GRCm39) N93Y probably damaging Het
Macf1 A T 4: 123,403,563 (GRCm39) probably null Het
Mink1 A G 11: 70,500,902 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Ntpcr A G 8: 126,472,074 (GRCm39) M132V probably benign Het
Or14a257 A G 7: 86,138,061 (GRCm39) S233P probably damaging Het
Or52n1 A G 7: 104,383,115 (GRCm39) M152T probably benign Het
Or7g32 T C 9: 19,408,098 (GRCm39) I18T probably benign Het
Padi2 A G 4: 140,660,590 (GRCm39) I357V probably benign Het
Pax7 G T 4: 139,506,920 (GRCm39) H372Q probably benign Het
Pde4b A C 4: 102,412,822 (GRCm39) D199A probably null Het
Pkd1l2 T C 8: 117,792,311 (GRCm39) N494D probably benign Het
Prdm2 G T 4: 142,862,580 (GRCm39) Q237K probably benign Het
Prune2 T C 19: 17,097,769 (GRCm39) L1091P probably damaging Het
Rab9 C T X: 165,240,754 (GRCm39) D186N probably benign Het
Rassf5 A G 1: 131,106,264 (GRCm39) *414Q probably null Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rrp9 C A 9: 106,360,388 (GRCm39) T238K probably benign Het
Slc44a2 A G 9: 21,259,882 (GRCm39) D630G probably benign Het
Slc7a9 A G 7: 35,156,443 (GRCm39) D295G probably benign Het
Slco3a1 A T 7: 73,934,054 (GRCm39) M706K possibly damaging Het
Spag9 T C 11: 93,962,514 (GRCm39) probably null Het
Stam2 A T 2: 52,590,180 (GRCm39) Y394N probably damaging Het
Stard9 T C 2: 120,510,442 (GRCm39) L341P probably damaging Het
Steap3 A T 1: 120,171,624 (GRCm39) H160Q probably damaging Het
Stxbp5l A T 16: 37,061,809 (GRCm39) C334S probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem74 A T 15: 43,731,456 (GRCm39) probably benign Het
Ttn T C 2: 76,537,480 (GRCm39) K34816R possibly damaging Het
Ttn T A 2: 76,627,735 (GRCm39) N14736I probably damaging Het
Vmn1r183 A G 7: 23,754,890 (GRCm39) Q231R possibly damaging Het
Vmn1r235 A G 17: 21,482,439 (GRCm39) T255A probably damaging Het
Wasl A T 6: 24,619,209 (GRCm39) I437K unknown Het
Ywhae A G 11: 75,642,769 (GRCm39) N43D probably damaging Het
Zfp583 A T 7: 6,320,210 (GRCm39) Y267* probably null Het
Zfp608 C T 18: 55,121,072 (GRCm39) G172R probably benign Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27,977,550 (GRCm39) utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27,953,857 (GRCm39) missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27,956,036 (GRCm39) missense probably benign 0.17
IGL02143:Paxip1 APN 5 27,980,596 (GRCm39) utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27,964,393 (GRCm39) missense probably benign 0.30
IGL02903:Paxip1 APN 5 27,953,870 (GRCm39) missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27,957,764 (GRCm39) missense probably benign 0.01
BB003:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
BB013:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
R0128:Paxip1 UTSW 5 27,949,183 (GRCm39) splice site probably benign
R0130:Paxip1 UTSW 5 27,949,183 (GRCm39) splice site probably benign
R0331:Paxip1 UTSW 5 27,970,230 (GRCm39) missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27,963,621 (GRCm39) splice site probably benign
R0370:Paxip1 UTSW 5 27,965,084 (GRCm39) missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27,970,940 (GRCm39) nonsense probably null
R1969:Paxip1 UTSW 5 27,949,134 (GRCm39) missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27,947,499 (GRCm39) missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27,980,671 (GRCm39) utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27,977,027 (GRCm39) unclassified probably benign
R3809:Paxip1 UTSW 5 27,977,027 (GRCm39) unclassified probably benign
R3881:Paxip1 UTSW 5 27,953,837 (GRCm39) missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27,953,837 (GRCm39) missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27,966,675 (GRCm39) splice site probably null
R4692:Paxip1 UTSW 5 27,977,095 (GRCm39) unclassified probably benign
R4776:Paxip1 UTSW 5 27,970,204 (GRCm39) missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27,971,282 (GRCm39) missense unknown
R5388:Paxip1 UTSW 5 27,986,453 (GRCm39) utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27,977,002 (GRCm39) unclassified probably benign
R5553:Paxip1 UTSW 5 27,980,637 (GRCm39) utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27,966,616 (GRCm39) missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27,971,171 (GRCm39) missense unknown
R6276:Paxip1 UTSW 5 27,966,666 (GRCm39) missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27,970,576 (GRCm39) splice site probably null
R6584:Paxip1 UTSW 5 27,963,450 (GRCm39) missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27,949,135 (GRCm39) missense probably benign 0.18
R6908:Paxip1 UTSW 5 27,996,222 (GRCm39) missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27,970,766 (GRCm39) nonsense probably null
R7252:Paxip1 UTSW 5 27,965,084 (GRCm39) missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27,986,418 (GRCm39) critical splice donor site probably null
R7585:Paxip1 UTSW 5 27,977,002 (GRCm39) missense unknown
R7665:Paxip1 UTSW 5 27,970,736 (GRCm39) missense unknown
R7926:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
R8169:Paxip1 UTSW 5 27,977,093 (GRCm39) missense unknown
R8335:Paxip1 UTSW 5 27,971,122 (GRCm39) missense unknown
R8790:Paxip1 UTSW 5 27,977,078 (GRCm39) missense unknown
X0066:Paxip1 UTSW 5 27,971,016 (GRCm39) missense unknown
Z1176:Paxip1 UTSW 5 27,988,727 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGCAGGTCGTTCTCACAG -3'
(R):5'- CAGTAGAGCAGGTGTTCTCTAC -3'

Sequencing Primer
(F):5'- AATGATCTCTGAAAGACTCTAGGG -3'
(R):5'- AGCAGGTGTTCTCTACTTTAATTTTG -3'
Posted On 2021-03-08