Incidental Mutation 'R8732:Pkd1l2'
ID 662811
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms 1700126L06Rik
MMRRC Submission 068580-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8732 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 117722418-117809188 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117792311 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 494 (N494D)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000098375
AA Change: N494D

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: N494D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109093
AA Change: N494D

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: N494D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,981,622 (GRCm39) N82K probably damaging Het
Ankrd36 T A 11: 5,578,906 (GRCm39) S57T possibly damaging Het
Aoc3 A G 11: 101,222,643 (GRCm39) N293S probably benign Het
Aup1 A T 6: 83,033,602 (GRCm39) H302L probably damaging Het
Bptf G A 11: 106,931,206 (GRCm39) R277W probably damaging Het
Cald1 A G 6: 34,734,946 (GRCm39) I346V unknown Het
Cd44 T C 2: 102,664,645 (GRCm39) T519A possibly damaging Het
Cela1 A G 15: 100,580,766 (GRCm39) probably null Het
Ces2g T C 8: 105,689,195 (GRCm39) V57A possibly damaging Het
Cpt1b G C 15: 89,308,628 (GRCm39) T100S probably benign Het
D6Wsu163e A T 6: 126,932,859 (GRCm39) I361F possibly damaging Het
Dock5 A T 14: 68,083,449 (GRCm39) D153E possibly damaging Het
Dync2h1 G T 9: 7,168,326 (GRCm39) R430S probably damaging Het
Dync2i2 T A 2: 29,922,220 (GRCm39) T414S possibly damaging Het
Efcab3 T A 11: 104,695,100 (GRCm39) F1730L probably benign Het
Eml5 C T 12: 98,782,218 (GRCm39) G1405R probably damaging Het
Ergic2 G A 6: 148,102,975 (GRCm39) A91V probably damaging Het
Fancl A T 11: 26,419,754 (GRCm39) I336L probably benign Het
Fpr3 A G 17: 18,191,223 (GRCm39) T165A possibly damaging Het
Gon4l A G 3: 88,807,291 (GRCm39) I1662V possibly damaging Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Hdac4 C A 1: 91,875,239 (GRCm39) A911S probably damaging Het
Ighd T C 12: 113,378,183 (GRCm39) N139D Het
Klhl22 T A 16: 17,589,690 (GRCm39) L117Q probably damaging Het
Kntc1 A G 5: 123,928,180 (GRCm39) S1226G probably benign Het
Lama5 A T 2: 179,828,481 (GRCm39) C2126S probably damaging Het
Ldlr A G 9: 21,650,985 (GRCm39) I468V probably benign Het
Lmtk3 G A 7: 45,447,712 (GRCm39) A1253T unknown Het
Lta T A 17: 35,423,045 (GRCm39) N93Y probably damaging Het
Macf1 A T 4: 123,403,563 (GRCm39) probably null Het
Mink1 A G 11: 70,500,902 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Ntpcr A G 8: 126,472,074 (GRCm39) M132V probably benign Het
Or14a257 A G 7: 86,138,061 (GRCm39) S233P probably damaging Het
Or52n1 A G 7: 104,383,115 (GRCm39) M152T probably benign Het
Or7g32 T C 9: 19,408,098 (GRCm39) I18T probably benign Het
Padi2 A G 4: 140,660,590 (GRCm39) I357V probably benign Het
Pax7 G T 4: 139,506,920 (GRCm39) H372Q probably benign Het
Paxip1 A G 5: 27,949,541 (GRCm39) Y966H probably damaging Het
Pde4b A C 4: 102,412,822 (GRCm39) D199A probably null Het
Prdm2 G T 4: 142,862,580 (GRCm39) Q237K probably benign Het
Prune2 T C 19: 17,097,769 (GRCm39) L1091P probably damaging Het
Rab9 C T X: 165,240,754 (GRCm39) D186N probably benign Het
Rassf5 A G 1: 131,106,264 (GRCm39) *414Q probably null Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rrp9 C A 9: 106,360,388 (GRCm39) T238K probably benign Het
Slc44a2 A G 9: 21,259,882 (GRCm39) D630G probably benign Het
Slc7a9 A G 7: 35,156,443 (GRCm39) D295G probably benign Het
Slco3a1 A T 7: 73,934,054 (GRCm39) M706K possibly damaging Het
Spag9 T C 11: 93,962,514 (GRCm39) probably null Het
Stam2 A T 2: 52,590,180 (GRCm39) Y394N probably damaging Het
Stard9 T C 2: 120,510,442 (GRCm39) L341P probably damaging Het
Steap3 A T 1: 120,171,624 (GRCm39) H160Q probably damaging Het
Stxbp5l A T 16: 37,061,809 (GRCm39) C334S probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem74 A T 15: 43,731,456 (GRCm39) probably benign Het
Ttn T C 2: 76,537,480 (GRCm39) K34816R possibly damaging Het
Ttn T A 2: 76,627,735 (GRCm39) N14736I probably damaging Het
Vmn1r183 A G 7: 23,754,890 (GRCm39) Q231R possibly damaging Het
Vmn1r235 A G 17: 21,482,439 (GRCm39) T255A probably damaging Het
Wasl A T 6: 24,619,209 (GRCm39) I437K unknown Het
Ywhae A G 11: 75,642,769 (GRCm39) N43D probably damaging Het
Zfp583 A T 7: 6,320,210 (GRCm39) Y267* probably null Het
Zfp608 C T 18: 55,121,072 (GRCm39) G172R probably benign Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117,786,259 (GRCm39) nonsense probably null
IGL01353:Pkd1l2 APN 8 117,784,182 (GRCm39) missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117,748,595 (GRCm39) missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117,786,331 (GRCm39) missense probably benign
IGL01672:Pkd1l2 APN 8 117,807,471 (GRCm39) missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117,783,126 (GRCm39) missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 117,724,913 (GRCm39) missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117,787,264 (GRCm39) missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117,743,655 (GRCm39) missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117,736,303 (GRCm39) splice site probably benign
IGL02381:Pkd1l2 APN 8 117,762,539 (GRCm39) splice site probably benign
IGL02416:Pkd1l2 APN 8 117,767,574 (GRCm39) missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117,767,405 (GRCm39) missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117,756,298 (GRCm39) missense probably benign
IGL02861:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117,740,630 (GRCm39) missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117,750,830 (GRCm39) missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 117,722,548 (GRCm39) missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117,792,484 (GRCm39) missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117,748,761 (GRCm39) missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117,776,787 (GRCm39) splice site probably benign
R0309:Pkd1l2 UTSW 8 117,724,315 (GRCm39) missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117,748,589 (GRCm39) missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117,808,999 (GRCm39) missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117,808,957 (GRCm39) missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117,777,839 (GRCm39) missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117,802,916 (GRCm39) missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117,771,231 (GRCm39) missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117,746,282 (GRCm39) critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117,781,673 (GRCm39) missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117,792,236 (GRCm39) splice site probably benign
R1491:Pkd1l2 UTSW 8 117,755,147 (GRCm39) missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117,772,898 (GRCm39) missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117,792,239 (GRCm39) splice site probably null
R1544:Pkd1l2 UTSW 8 117,764,974 (GRCm39) frame shift probably null
R1558:Pkd1l2 UTSW 8 117,808,991 (GRCm39) missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117,767,514 (GRCm39) missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117,783,158 (GRCm39) missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117,757,458 (GRCm39) missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117,772,921 (GRCm39) nonsense probably null
R1955:Pkd1l2 UTSW 8 117,770,100 (GRCm39) missense probably benign
R1957:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117,769,970 (GRCm39) critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117,746,272 (GRCm39) missense probably benign
R2046:Pkd1l2 UTSW 8 117,726,694 (GRCm39) missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117,808,208 (GRCm39) missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117,757,461 (GRCm39) missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117,783,064 (GRCm39) missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117,770,056 (GRCm39) missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117,746,233 (GRCm39) missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117,792,290 (GRCm39) missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117,795,054 (GRCm39) critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117,767,478 (GRCm39) missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117,746,168 (GRCm39) missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117,738,314 (GRCm39) missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117,781,624 (GRCm39) missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117,799,288 (GRCm39) missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117,774,113 (GRCm39) splice site probably null
R5057:Pkd1l2 UTSW 8 117,781,747 (GRCm39) missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117,783,181 (GRCm39) missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117,761,857 (GRCm39) missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117,757,388 (GRCm39) missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117,792,569 (GRCm39) missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117,794,855 (GRCm39) missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117,767,522 (GRCm39) nonsense probably null
R5610:Pkd1l2 UTSW 8 117,769,059 (GRCm39) missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117,781,757 (GRCm39) missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117,792,485 (GRCm39) missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117,781,750 (GRCm39) missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 117,724,321 (GRCm39) missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117,756,387 (GRCm39) missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117,750,795 (GRCm39) missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117,740,726 (GRCm39) missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117,809,107 (GRCm39) missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117,808,209 (GRCm39) missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117,762,586 (GRCm39) missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117,767,405 (GRCm39) missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117,757,370 (GRCm39) missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117,740,681 (GRCm39) missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117,802,870 (GRCm39) nonsense probably null
R7148:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117,767,574 (GRCm39) missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 117,722,536 (GRCm39) missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117,750,773 (GRCm39) missense probably benign
R7382:Pkd1l2 UTSW 8 117,781,610 (GRCm39) missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117,762,641 (GRCm39) missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117,755,218 (GRCm39) missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117,794,849 (GRCm39) missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117,787,333 (GRCm39) missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117,792,268 (GRCm39) missense probably benign
R7590:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117,756,384 (GRCm39) missense probably damaging 1.00
R7768:Pkd1l2 UTSW 8 117,781,599 (GRCm39) critical splice donor site probably null
R7897:Pkd1l2 UTSW 8 117,724,827 (GRCm39) missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117,777,926 (GRCm39) missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117,802,921 (GRCm39) missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117,774,236 (GRCm39) missense probably benign
R8145:Pkd1l2 UTSW 8 117,781,742 (GRCm39) missense probably benign
R8228:Pkd1l2 UTSW 8 117,792,514 (GRCm39) missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117,767,472 (GRCm39) missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117,774,302 (GRCm39) critical splice acceptor site probably null
R8809:Pkd1l2 UTSW 8 117,726,660 (GRCm39) missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117,740,615 (GRCm39) missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 117,726,717 (GRCm39) missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117,764,849 (GRCm39) missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117,769,037 (GRCm39) missense probably benign 0.32
R9091:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9138:Pkd1l2 UTSW 8 117,781,748 (GRCm39) missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117,746,159 (GRCm39) missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9735:Pkd1l2 UTSW 8 117,772,820 (GRCm39) missense possibly damaging 0.94
Z1176:Pkd1l2 UTSW 8 117,781,653 (GRCm39) missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117,757,430 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGATCCTCATACCTGCCTG -3'
(R):5'- CCTAAAGATCCAAGCTGTCAGC -3'

Sequencing Primer
(F):5'- GGTGTCATCTCTTTCCTGGTAC -3'
(R):5'- CTGTCAGCAATGAAGGCACCG -3'
Posted On 2021-03-08