Incidental Mutation 'R8732:Dock5'
ID 662829
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R8732 (G1)
Quality Score 174.009
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67846000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 153 (D153E)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect possibly damaging
Transcript: ENSMUST00000039135
AA Change: D153E

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: D153E

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,828,146 N82K probably damaging Het
Ankrd36 T A 11: 5,628,906 S57T possibly damaging Het
Aoc3 A G 11: 101,331,817 N293S probably benign Het
Aup1 A T 6: 83,056,621 H302L probably damaging Het
Bptf G A 11: 107,040,380 R277W probably damaging Het
Cald1 A G 6: 34,758,011 I346V unknown Het
Cd44 T C 2: 102,834,300 T519A possibly damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Ces2g T C 8: 104,962,563 V57A possibly damaging Het
Cpt1b G C 15: 89,424,425 T100S probably benign Het
D6Wsu163e A T 6: 126,955,896 I361F possibly damaging Het
Dync2h1 G T 9: 7,168,326 R430S probably damaging Het
Eml5 C T 12: 98,815,959 G1405R probably damaging Het
Ergic2 G A 6: 148,201,477 A91V probably damaging Het
Fancl A T 11: 26,469,754 I336L probably benign Het
Fpr3 A G 17: 17,970,961 T165A possibly damaging Het
Gm11639 T A 11: 104,804,274 F1730L probably benign Het
Gon4l A G 3: 88,899,984 I1662V possibly damaging Het
Gpr153 C T 4: 152,279,101 probably benign Het
Hdac4 C A 1: 91,947,517 A911S probably damaging Het
Ighd T C 12: 113,414,563 N139D Het
Klhl22 T A 16: 17,771,826 L117Q probably damaging Het
Kntc1 A G 5: 123,790,117 S1226G probably benign Het
Lama5 A T 2: 180,186,688 C2126S probably damaging Het
Ldlr A G 9: 21,739,689 I468V probably benign Het
Lmtk3 G A 7: 45,798,288 A1253T unknown Het
Lta T A 17: 35,204,069 N93Y probably damaging Het
Macf1 A T 4: 123,509,770 probably null Het
Mink1 A G 11: 70,610,076 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ntpcr A G 8: 125,745,335 M132V probably benign Het
Olfr298 A G 7: 86,488,853 S233P probably damaging Het
Olfr664 A G 7: 104,733,908 M152T probably benign Het
Olfr851 T C 9: 19,496,802 I18T probably benign Het
Padi2 A G 4: 140,933,279 I357V probably benign Het
Pax7 G T 4: 139,779,609 H372Q probably benign Het
Paxip1 A G 5: 27,744,543 Y966H probably damaging Het
Pde4b A C 4: 102,555,625 D199A probably null Het
Pkd1l2 T C 8: 117,065,572 N494D probably benign Het
Prdm2 G T 4: 143,136,010 Q237K probably benign Het
Prune2 T C 19: 17,120,405 L1091P probably damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Rassf5 A G 1: 131,178,527 *414Q probably null Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rrp9 C A 9: 106,483,189 T238K probably benign Het
Slc44a2 A G 9: 21,348,586 D630G probably benign Het
Slc7a9 A G 7: 35,457,018 D295G probably benign Het
Slco3a1 A T 7: 74,284,306 M706K possibly damaging Het
Spag9 T C 11: 94,071,688 probably null Het
Stam2 A T 2: 52,700,168 Y394N probably damaging Het
Stard9 T C 2: 120,679,961 L341P probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Stxbp5l A T 16: 37,241,447 C334S probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem74 A T 15: 43,868,060 probably benign Het
Ttn T C 2: 76,707,136 K34816R possibly damaging Het
Ttn T A 2: 76,797,391 N14736I probably damaging Het
Vmn1r183 A G 7: 24,055,465 Q231R possibly damaging Het
Vmn1r235 A G 17: 21,262,177 T255A probably damaging Het
Wasl A T 6: 24,619,210 I437K unknown Het
Wdr34 T A 2: 30,032,208 T414S possibly damaging Het
Ywhae A G 11: 75,751,943 N43D probably damaging Het
Zfp583 A T 7: 6,317,211 Y267* probably null Het
Zfp608 C T 18: 54,988,000 G172R probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTCCCCAAGAGTCACTGATAC -3'
(R):5'- AGATGCCTTCTCTTCATTGCA -3'

Sequencing Primer
(F):5'- CTGTAAAGTCCTGGGATCAGAGCTC -3'
(R):5'- ATTGCATCTTTATGGTTCTCTCTG -3'
Posted On 2021-03-08