Incidental Mutation 'R8732:Dock5'
ID 662829
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 068580-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.389) question?
Stock # R8732 (G1)
Quality Score 174.009
Status Validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68083449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 153 (D153E)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect possibly damaging
Transcript: ENSMUST00000039135
AA Change: D153E

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: D153E

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,981,622 (GRCm39) N82K probably damaging Het
Ankrd36 T A 11: 5,578,906 (GRCm39) S57T possibly damaging Het
Aoc3 A G 11: 101,222,643 (GRCm39) N293S probably benign Het
Aup1 A T 6: 83,033,602 (GRCm39) H302L probably damaging Het
Bptf G A 11: 106,931,206 (GRCm39) R277W probably damaging Het
Cald1 A G 6: 34,734,946 (GRCm39) I346V unknown Het
Cd44 T C 2: 102,664,645 (GRCm39) T519A possibly damaging Het
Cela1 A G 15: 100,580,766 (GRCm39) probably null Het
Ces2g T C 8: 105,689,195 (GRCm39) V57A possibly damaging Het
Cpt1b G C 15: 89,308,628 (GRCm39) T100S probably benign Het
D6Wsu163e A T 6: 126,932,859 (GRCm39) I361F possibly damaging Het
Dync2h1 G T 9: 7,168,326 (GRCm39) R430S probably damaging Het
Dync2i2 T A 2: 29,922,220 (GRCm39) T414S possibly damaging Het
Efcab3 T A 11: 104,695,100 (GRCm39) F1730L probably benign Het
Eml5 C T 12: 98,782,218 (GRCm39) G1405R probably damaging Het
Ergic2 G A 6: 148,102,975 (GRCm39) A91V probably damaging Het
Fancl A T 11: 26,419,754 (GRCm39) I336L probably benign Het
Fpr3 A G 17: 18,191,223 (GRCm39) T165A possibly damaging Het
Gon4l A G 3: 88,807,291 (GRCm39) I1662V possibly damaging Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Hdac4 C A 1: 91,875,239 (GRCm39) A911S probably damaging Het
Ighd T C 12: 113,378,183 (GRCm39) N139D Het
Klhl22 T A 16: 17,589,690 (GRCm39) L117Q probably damaging Het
Kntc1 A G 5: 123,928,180 (GRCm39) S1226G probably benign Het
Lama5 A T 2: 179,828,481 (GRCm39) C2126S probably damaging Het
Ldlr A G 9: 21,650,985 (GRCm39) I468V probably benign Het
Lmtk3 G A 7: 45,447,712 (GRCm39) A1253T unknown Het
Lta T A 17: 35,423,045 (GRCm39) N93Y probably damaging Het
Macf1 A T 4: 123,403,563 (GRCm39) probably null Het
Mink1 A G 11: 70,500,902 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Ntpcr A G 8: 126,472,074 (GRCm39) M132V probably benign Het
Or14a257 A G 7: 86,138,061 (GRCm39) S233P probably damaging Het
Or52n1 A G 7: 104,383,115 (GRCm39) M152T probably benign Het
Or7g32 T C 9: 19,408,098 (GRCm39) I18T probably benign Het
Padi2 A G 4: 140,660,590 (GRCm39) I357V probably benign Het
Pax7 G T 4: 139,506,920 (GRCm39) H372Q probably benign Het
Paxip1 A G 5: 27,949,541 (GRCm39) Y966H probably damaging Het
Pde4b A C 4: 102,412,822 (GRCm39) D199A probably null Het
Pkd1l2 T C 8: 117,792,311 (GRCm39) N494D probably benign Het
Prdm2 G T 4: 142,862,580 (GRCm39) Q237K probably benign Het
Prune2 T C 19: 17,097,769 (GRCm39) L1091P probably damaging Het
Rab9 C T X: 165,240,754 (GRCm39) D186N probably benign Het
Rassf5 A G 1: 131,106,264 (GRCm39) *414Q probably null Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rrp9 C A 9: 106,360,388 (GRCm39) T238K probably benign Het
Slc44a2 A G 9: 21,259,882 (GRCm39) D630G probably benign Het
Slc7a9 A G 7: 35,156,443 (GRCm39) D295G probably benign Het
Slco3a1 A T 7: 73,934,054 (GRCm39) M706K possibly damaging Het
Spag9 T C 11: 93,962,514 (GRCm39) probably null Het
Stam2 A T 2: 52,590,180 (GRCm39) Y394N probably damaging Het
Stard9 T C 2: 120,510,442 (GRCm39) L341P probably damaging Het
Steap3 A T 1: 120,171,624 (GRCm39) H160Q probably damaging Het
Stxbp5l A T 16: 37,061,809 (GRCm39) C334S probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem74 A T 15: 43,731,456 (GRCm39) probably benign Het
Ttn T C 2: 76,537,480 (GRCm39) K34816R possibly damaging Het
Ttn T A 2: 76,627,735 (GRCm39) N14736I probably damaging Het
Vmn1r183 A G 7: 23,754,890 (GRCm39) Q231R possibly damaging Het
Vmn1r235 A G 17: 21,482,439 (GRCm39) T255A probably damaging Het
Wasl A T 6: 24,619,209 (GRCm39) I437K unknown Het
Ywhae A G 11: 75,642,769 (GRCm39) N43D probably damaging Het
Zfp583 A T 7: 6,320,210 (GRCm39) Y267* probably null Het
Zfp608 C T 18: 55,121,072 (GRCm39) G172R probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7588:Dock5 UTSW 14 68,000,607 (GRCm39) critical splice donor site probably null
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 68,033,454 (GRCm39) missense probably benign 0.44
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8044:Dock5 UTSW 14 68,062,141 (GRCm39) missense probably damaging 1.00
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8353:Dock5 UTSW 14 68,054,957 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8708:Dock5 UTSW 14 68,004,820 (GRCm39) missense probably benign 0.02
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R8972:Dock5 UTSW 14 68,013,749 (GRCm39) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTCCCCAAGAGTCACTGATAC -3'
(R):5'- AGATGCCTTCTCTTCATTGCA -3'

Sequencing Primer
(F):5'- CTGTAAAGTCCTGGGATCAGAGCTC -3'
(R):5'- ATTGCATCTTTATGGTTCTCTCTG -3'
Posted On 2021-03-08