Mutagenetix > Incidental Mutation

Incidental Mutation 'R8732:Zfp608'

662837

Institutional Source

Beutler Lab

Gene Symbol

Zfp608

Ensembl Gene

ENSMUSG00000052713

Gene Name

zinc finger protein 608

Synonyms

4932417D18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.895) question?

Stock #

R8732 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54888045-54990180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54988000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 172 (G172R)

Ref Sequence

ENSEMBL: ENSMUSP00000068192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064763]

AlphaFold

Q56A10

Predicted Effect

probably benign
Transcript: ENSMUST00000064763
AA Change: G172R

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: G172R

Domain	Start	End	E-Value	Type
low complexity region	51	61	N/A	INTRINSIC
low complexity region	150	184	N/A	INTRINSIC
low complexity region	214	234	N/A	INTRINSIC
low complexity region	252	266	N/A	INTRINSIC
low complexity region	309	326	N/A	INTRINSIC
low complexity region	428	445	N/A	INTRINSIC
low complexity region	459	471	N/A	INTRINSIC
ZnF_C2H2	552	577	1.86e0	SMART
low complexity region	624	636	N/A	INTRINSIC
low complexity region	706	718	N/A	INTRINSIC
low complexity region	734	773	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	833	846	N/A	INTRINSIC
low complexity region	934	956	N/A	INTRINSIC
coiled coil region	1028	1054	N/A	INTRINSIC
low complexity region	1182	1193	N/A	INTRINSIC
low complexity region	1255	1268	N/A	INTRINSIC
low complexity region	1439	1450	N/A	INTRINSIC
low complexity region	1458	1466	N/A	INTRINSIC
low complexity region	1486	1502	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.0%

Validation Efficiency

98% (63/64)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adtrp	A	T	13: 41,828,146	N82K	probably damaging	Het
Ankrd36	T	A	11: 5,628,906	S57T	possibly damaging	Het
Aoc3	A	G	11: 101,331,817	N293S	probably benign	Het
Aup1	A	T	6: 83,056,621	H302L	probably damaging	Het
Bptf	G	A	11: 107,040,380	R277W	probably damaging	Het
Cald1	A	G	6: 34,758,011	I346V	unknown	Het
Cd44	T	C	2: 102,834,300	T519A	possibly damaging	Het
Cela1	A	G	15: 100,682,885		probably null	Het
Ces2g	T	C	8: 104,962,563	V57A	possibly damaging	Het
Cpt1b	G	C	15: 89,424,425	T100S	probably benign	Het
D6Wsu163e	A	T	6: 126,955,896	I361F	possibly damaging	Het
Dock5	A	T	14: 67,846,000	D153E	possibly damaging	Het
Dync2h1	G	T	9: 7,168,326	R430S	probably damaging	Het
Eml5	C	T	12: 98,815,959	G1405R	probably damaging	Het
Ergic2	G	A	6: 148,201,477	A91V	probably damaging	Het
Fancl	A	T	11: 26,469,754	I336L	probably benign	Het
Fpr3	A	G	17: 17,970,961	T165A	possibly damaging	Het
Gm11639	T	A	11: 104,804,274	F1730L	probably benign	Het
Gon4l	A	G	3: 88,899,984	I1662V	possibly damaging	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Hdac4	C	A	1: 91,947,517	A911S	probably damaging	Het
Ighd	T	C	12: 113,414,563	N139D		Het
Klhl22	T	A	16: 17,771,826	L117Q	probably damaging	Het
Kntc1	A	G	5: 123,790,117	S1226G	probably benign	Het
Lama5	A	T	2: 180,186,688	C2126S	probably damaging	Het
Ldlr	A	G	9: 21,739,689	I468V	probably benign	Het
Lmtk3	G	A	7: 45,798,288	A1253T	unknown	Het
Lta	T	A	17: 35,204,069	N93Y	probably damaging	Het
Macf1	A	T	4: 123,509,770		probably null	Het
Mink1	A	G	11: 70,610,076		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Ntpcr	A	G	8: 125,745,335	M132V	probably benign	Het
Olfr298	A	G	7: 86,488,853	S233P	probably damaging	Het
Olfr664	A	G	7: 104,733,908	M152T	probably benign	Het
Olfr851	T	C	9: 19,496,802	I18T	probably benign	Het
Padi2	A	G	4: 140,933,279	I357V	probably benign	Het
Pax7	G	T	4: 139,779,609	H372Q	probably benign	Het
Paxip1	A	G	5: 27,744,543	Y966H	probably damaging	Het
Pde4b	A	C	4: 102,555,625	D199A	probably null	Het
Pkd1l2	T	C	8: 117,065,572	N494D	probably benign	Het
Prdm2	G	T	4: 143,136,010	Q237K	probably benign	Het
Prune2	T	C	19: 17,120,405	L1091P	probably damaging	Het
Rab9	C	T	X: 166,457,758	D186N	probably benign	Het
Rassf5	A	G	1: 131,178,527	*414Q	probably null	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rrp9	C	A	9: 106,483,189	T238K	probably benign	Het
Slc44a2	A	G	9: 21,348,586	D630G	probably benign	Het
Slc7a9	A	G	7: 35,457,018	D295G	probably benign	Het
Slco3a1	A	T	7: 74,284,306	M706K	possibly damaging	Het
Spag9	T	C	11: 94,071,688		probably null	Het
Stam2	A	T	2: 52,700,168	Y394N	probably damaging	Het
Stard9	T	C	2: 120,679,961	L341P	probably damaging	Het
Steap3	A	T	1: 120,243,894	H160Q	probably damaging	Het
Stxbp5l	A	T	16: 37,241,447	C334S	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem74	A	T	15: 43,868,060		probably benign	Het
Ttn	T	C	2: 76,707,136	K34816R	possibly damaging	Het
Ttn	T	A	2: 76,797,391	N14736I	probably damaging	Het
Vmn1r183	A	G	7: 24,055,465	Q231R	possibly damaging	Het
Vmn1r235	A	G	17: 21,262,177	T255A	probably damaging	Het
Wasl	A	T	6: 24,619,210	I437K	unknown	Het
Wdr34	T	A	2: 30,032,208	T414S	possibly damaging	Het
Ywhae	A	G	11: 75,751,943	N43D	probably damaging	Het
Zfp583	A	T	7: 6,317,211	Y267*	probably null	Het

Other mutations in Zfp608

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Zfp608	APN	18	54988333	missense	probably benign
IGL00920:Zfp608	APN	18	54889831	missense	probably benign	0.00
IGL01088:Zfp608	APN	18	54898087	missense	probably benign	0.03
IGL01447:Zfp608	APN	18	54899011	missense	possibly damaging	0.75
IGL01534:Zfp608	APN	18	54898932	missense	probably damaging	0.99
IGL01547:Zfp608	APN	18	54894449	critical splice donor site	probably null
IGL01933:Zfp608	APN	18	54987799	missense	probably benign
IGL01998:Zfp608	APN	18	54891818	missense	probably damaging	0.99
IGL02167:Zfp608	APN	18	54988224	missense	probably damaging	1.00
IGL02266:Zfp608	APN	18	54897581	missense	probably benign	0.08
IGL02335:Zfp608	APN	18	54897437	nonsense	probably null
IGL02455:Zfp608	APN	18	54899333	missense	probably damaging	1.00
IGL02612:Zfp608	APN	18	54898201	missense	probably damaging	1.00
IGL02900:Zfp608	APN	18	54946793	missense	probably damaging	1.00
PIT4243001:Zfp608	UTSW	18	54898024	missense	probably damaging	1.00
PIT4519001:Zfp608	UTSW	18	54946711	missense	possibly damaging	0.71
R0005:Zfp608	UTSW	18	54895520	missense	possibly damaging	0.88
R0010:Zfp608	UTSW	18	54895214	splice site	probably benign
R0010:Zfp608	UTSW	18	54895214	splice site	probably benign
R0064:Zfp608	UTSW	18	54898816	missense	probably benign
R0401:Zfp608	UTSW	18	54898994	missense	probably benign
R0722:Zfp608	UTSW	18	54900234	missense	probably damaging	1.00
R1351:Zfp608	UTSW	18	54898391	missense	probably benign	0.00
R1512:Zfp608	UTSW	18	54946666	missense	probably damaging	1.00
R1554:Zfp608	UTSW	18	54898054	missense	probably damaging	1.00
R1622:Zfp608	UTSW	18	54988294	missense	probably benign	0.07
R1669:Zfp608	UTSW	18	54987739	missense	probably benign	0.09
R1690:Zfp608	UTSW	18	54987634	missense	possibly damaging	0.62
R1721:Zfp608	UTSW	18	54899249	missense	probably benign
R1826:Zfp608	UTSW	18	54898576	missense	probably benign	0.03
R1864:Zfp608	UTSW	18	54897911	missense	probably benign	0.00
R1952:Zfp608	UTSW	18	54897779	nonsense	probably null
R2049:Zfp608	UTSW	18	54895565	missense	probably damaging	1.00
R2051:Zfp608	UTSW	18	54988314	missense	probably benign
R2168:Zfp608	UTSW	18	54898053	nonsense	probably null
R2218:Zfp608	UTSW	18	54987684	missense	probably benign	0.14
R2283:Zfp608	UTSW	18	54988374	missense	probably damaging	1.00
R2399:Zfp608	UTSW	18	54897902	missense	probably damaging	1.00
R2520:Zfp608	UTSW	18	54988506	missense	possibly damaging	0.92
R2961:Zfp608	UTSW	18	54898472	missense	possibly damaging	0.60
R4074:Zfp608	UTSW	18	54898108	missense	probably damaging	1.00
R4076:Zfp608	UTSW	18	54898108	missense	probably damaging	1.00
R4206:Zfp608	UTSW	18	54988195	missense	probably damaging	1.00
R4756:Zfp608	UTSW	18	54894472	missense	probably damaging	1.00
R4771:Zfp608	UTSW	18	54988300	missense	probably benign
R4820:Zfp608	UTSW	18	54987684	missense	probably benign	0.14
R4825:Zfp608	UTSW	18	54897969	missense	probably benign	0.01
R4912:Zfp608	UTSW	18	54946591	missense	probably damaging	1.00
R4975:Zfp608	UTSW	18	54889890	missense	probably damaging	1.00
R5138:Zfp608	UTSW	18	54891799	missense	probably damaging	1.00
R5192:Zfp608	UTSW	18	54898497	missense	probably damaging	1.00
R5557:Zfp608	UTSW	18	54987870	missense	possibly damaging	0.81
R5624:Zfp608	UTSW	18	54898272	missense	probably damaging	1.00
R5818:Zfp608	UTSW	18	54895396	missense	probably benign	0.02
R5840:Zfp608	UTSW	18	54898906	missense	probably damaging	1.00
R5992:Zfp608	UTSW	18	54899248	missense	probably benign	0.15
R6106:Zfp608	UTSW	18	54987872	missense	possibly damaging	0.54
R6174:Zfp608	UTSW	18	54988544	start gained	probably benign
R6181:Zfp608	UTSW	18	54895628	missense	possibly damaging	0.56
R6517:Zfp608	UTSW	18	54899078	missense	possibly damaging	0.94
R6567:Zfp608	UTSW	18	54897556	missense	probably damaging	1.00
R6668:Zfp608	UTSW	18	54898019	missense	probably damaging	1.00
R6920:Zfp608	UTSW	18	54988265	missense	probably damaging	1.00
R7061:Zfp608	UTSW	18	54987997	missense	probably benign
R7074:Zfp608	UTSW	18	54897382	missense	possibly damaging	0.69
R7087:Zfp608	UTSW	18	54899397	missense	probably damaging	1.00
R7391:Zfp608	UTSW	18	54897547	missense	possibly damaging	0.49
R7600:Zfp608	UTSW	18	54988020	missense	probably damaging	1.00
R7723:Zfp608	UTSW	18	54897601	missense	probably damaging	1.00
R8054:Zfp608	UTSW	18	54899546	missense	probably benign	0.28
R8236:Zfp608	UTSW	18	54899209	missense	probably damaging	1.00
R8260:Zfp608	UTSW	18	54897749	missense	possibly damaging	0.60
R8781:Zfp608	UTSW	18	54898729	missense	probably damaging	1.00
R8851:Zfp608	UTSW	18	54899122	missense	possibly damaging	0.94
R8940:Zfp608	UTSW	18	54900229	missense	possibly damaging	0.93
R9051:Zfp608	UTSW	18	54899194	missense	probably damaging	1.00
R9091:Zfp608	UTSW	18	54899118	missense	probably damaging	1.00
R9092:Zfp608	UTSW	18	54898576	missense	probably benign	0.03
R9236:Zfp608	UTSW	18	54899282	missense	probably benign	0.39
R9270:Zfp608	UTSW	18	54899118	missense	probably damaging	1.00
R9283:Zfp608	UTSW	18	54897841	missense	possibly damaging	0.50
R9288:Zfp608	UTSW	18	54900269	missense	probably benign	0.39
R9463:Zfp608	UTSW	18	54897202	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGGTCCCAAAGCCATAGAGG -3'
(R):5'- GGGCTAAAACTTCTAAGGATGC -3'

Sequencing Primer
(F):5'- GTCCCAAAGCCATAGAGGTGACC -3'
(R):5'- GGATGCTAATAAATCTCTGCCTTCTG -3'

Posted On

2021-03-08