Incidental Mutation 'R8733:Pik3c2g'
ID662857
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8733 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 139768700 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 311 (Q311*)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect probably null
Transcript: ENSMUST00000111868
AA Change: Q311*
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: Q311*

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218528
AA Change: Q193*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,358,801 L1106P probably damaging Het
Alx3 C G 3: 107,604,819 P258A probably damaging Het
Bbs9 A G 9: 22,670,832 T607A probably benign Het
Catsperg1 A T 7: 29,191,686 V644E possibly damaging Het
Cep85 T C 4: 134,148,161 K499E possibly damaging Het
Chd5 A T 4: 152,379,466 H1464L probably damaging Het
Chrne A G 11: 70,617,030 L281P probably damaging Het
Cpsf4l A G 11: 113,709,453 F13L possibly damaging Het
Dgcr8 T C 16: 18,259,961 I603V probably benign Het
Dhx16 A G 17: 35,881,375 D102G probably benign Het
Dnm1 G T 2: 32,316,975 D564E probably benign Het
Dync1li1 T A 9: 114,705,110 Y93N probably damaging Het
Esp31 A G 17: 38,644,618 I51V probably benign Het
Grap G T 11: 61,671,691 A163S possibly damaging Het
Hgs G A 11: 120,470,128 probably null Het
Icosl A T 10: 78,073,863 N214I probably damaging Het
Ints6 G A 14: 62,696,848 P737S probably benign Het
Lima1 A G 15: 99,780,818 S581P probably damaging Het
Lrfn2 G A 17: 49,096,796 R649H probably damaging Het
Mrvi1 C T 7: 110,878,218 V564M probably benign Het
Muc5b A G 7: 141,863,795 T3493A possibly damaging Het
Mup4 A T 4: 59,958,587 N104K probably damaging Het
Nedd4 T C 9: 72,726,484 V424A possibly damaging Het
Olfr1117-ps1 A T 2: 87,284,772 I161F probably benign Het
Olfr794 T A 10: 129,570,710 D18E possibly damaging Het
Olfr930 A G 9: 38,930,689 I173V probably benign Het
Otop1 G A 5: 38,299,773 R292H probably damaging Het
Otop1 T A 5: 38,300,453 C518* probably null Het
Parp3 C T 9: 106,475,951 V9M probably benign Het
Pcdhb20 C T 18: 37,505,384 A321V probably damaging Het
Pkd1l1 A T 11: 8,933,657 V855D Het
Polr2k T A 15: 36,176,767 D97E probably benign Het
Ralgapa2 G A 2: 146,424,763 T631M probably damaging Het
Ralgps1 C A 2: 33,284,824 probably null Het
Rbm18 A G 2: 36,134,199 S17P probably damaging Het
Rcc1 C A 4: 132,338,204 L49F probably benign Het
Rgma T C 7: 73,409,288 S63P possibly damaging Het
Scn1a T A 2: 66,324,600 I672L probably benign Het
Sema4c T C 1: 36,552,873 T270A probably damaging Het
Serac1 A G 17: 6,050,028 L479P probably damaging Het
Slc22a16 A G 10: 40,574,065 M187V probably benign Het
Slc41a3 A T 6: 90,633,728 T191S possibly damaging Het
Slu7 G A 11: 43,443,340 V398M probably damaging Het
Sphk1 A G 11: 116,535,625 T136A probably benign Het
Sqstm1 G T 11: 50,210,666 P31Q possibly damaging Het
Trappc11 A T 8: 47,501,848 V885D probably damaging Het
Trav6-1 T A 14: 52,638,756 Y44* probably null Het
Trav9-2 T A 14: 53,591,298 C42S probably damaging Het
Zc2hc1a A G 3: 7,528,108 T194A probably benign Het
Zfp729a A G 13: 67,620,985 V375A probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8809:Pik3c2g UTSW 6 139768710 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTAGAATTTACTCTGTGTCC -3'
(R):5'- ATAGCAGGTTAGTGATTTCATGGGC -3'

Sequencing Primer
(F):5'- GGGGCATGTCTCCACCAAATATG -3'
(R):5'- CATGGGCTTGCAGTGGGAAC -3'
Posted On2021-03-08