Incidental Mutation 'R8733:Trappc11'
ID662862
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8733 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47501848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 885 (V885D)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]
Predicted Effect probably damaging
Transcript: ENSMUST00000039061
AA Change: V885D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: V885D

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120987
SMART Domains Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

DomainStartEndE-ValueType
Pfam:Gryzun 1 155 4e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,358,801 L1106P probably damaging Het
Alx3 C G 3: 107,604,819 P258A probably damaging Het
Bbs9 A G 9: 22,670,832 T607A probably benign Het
Catsperg1 A T 7: 29,191,686 V644E possibly damaging Het
Cep85 T C 4: 134,148,161 K499E possibly damaging Het
Chd5 A T 4: 152,379,466 H1464L probably damaging Het
Chrne A G 11: 70,617,030 L281P probably damaging Het
Cpsf4l A G 11: 113,709,453 F13L possibly damaging Het
Dgcr8 T C 16: 18,259,961 I603V probably benign Het
Dhx16 A G 17: 35,881,375 D102G probably benign Het
Dnm1 G T 2: 32,316,975 D564E probably benign Het
Dync1li1 T A 9: 114,705,110 Y93N probably damaging Het
Esp31 A G 17: 38,644,618 I51V probably benign Het
Grap G T 11: 61,671,691 A163S possibly damaging Het
Hgs G A 11: 120,470,128 probably null Het
Icosl A T 10: 78,073,863 N214I probably damaging Het
Ints6 G A 14: 62,696,848 P737S probably benign Het
Lima1 A G 15: 99,780,818 S581P probably damaging Het
Lrfn2 G A 17: 49,096,796 R649H probably damaging Het
Mrvi1 C T 7: 110,878,218 V564M probably benign Het
Muc5b A G 7: 141,863,795 T3493A possibly damaging Het
Mup4 A T 4: 59,958,587 N104K probably damaging Het
Nedd4 T C 9: 72,726,484 V424A possibly damaging Het
Olfr1117-ps1 A T 2: 87,284,772 I161F probably benign Het
Olfr794 T A 10: 129,570,710 D18E possibly damaging Het
Olfr930 A G 9: 38,930,689 I173V probably benign Het
Otop1 G A 5: 38,299,773 R292H probably damaging Het
Otop1 T A 5: 38,300,453 C518* probably null Het
Parp3 C T 9: 106,475,951 V9M probably benign Het
Pcdhb20 C T 18: 37,505,384 A321V probably damaging Het
Pik3c2g C T 6: 139,768,700 Q311* probably null Het
Pkd1l1 A T 11: 8,933,657 V855D Het
Polr2k T A 15: 36,176,767 D97E probably benign Het
Ralgapa2 G A 2: 146,424,763 T631M probably damaging Het
Ralgps1 C A 2: 33,284,824 probably null Het
Rbm18 A G 2: 36,134,199 S17P probably damaging Het
Rcc1 C A 4: 132,338,204 L49F probably benign Het
Rgma T C 7: 73,409,288 S63P possibly damaging Het
Scn1a T A 2: 66,324,600 I672L probably benign Het
Sema4c T C 1: 36,552,873 T270A probably damaging Het
Serac1 A G 17: 6,050,028 L479P probably damaging Het
Slc22a16 A G 10: 40,574,065 M187V probably benign Het
Slc41a3 A T 6: 90,633,728 T191S possibly damaging Het
Slu7 G A 11: 43,443,340 V398M probably damaging Het
Sphk1 A G 11: 116,535,625 T136A probably benign Het
Sqstm1 G T 11: 50,210,666 P31Q possibly damaging Het
Trav6-1 T A 14: 52,638,756 Y44* probably null Het
Trav9-2 T A 14: 53,591,298 C42S probably damaging Het
Zc2hc1a A G 3: 7,528,108 T194A probably benign Het
Zfp729a A G 13: 67,620,985 V375A probably damaging Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 splice site probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 splice site probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 splice site probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R7964:Trappc11 UTSW 8 47526944 missense possibly damaging 0.54
R8183:Trappc11 UTSW 8 47529356 missense possibly damaging 0.93
R8282:Trappc11 UTSW 8 47516589 missense probably damaging 0.97
R8782:Trappc11 UTSW 8 47498666 missense probably benign 0.44
R8853:Trappc11 UTSW 8 47529404 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATCAACAGGAAGGGGATGTC -3'
(R):5'- ACAGTCAGAGAACTCATTGAGG -3'

Sequencing Primer
(F):5'- CTGCATAGACTCTTTCCAGGTG -3'
(R):5'- CTCATTGAGGAGAGCAGGTCATTATG -3'
Posted On2021-03-08