Incidental Mutation 'R8734:Apmap'
ID662902
Institutional Source Beutler Lab
Gene Symbol Apmap
Ensembl Gene ENSMUSG00000033096
Gene Nameadipocyte plasma membrane associated protein
Synonyms2310001A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8734 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150583080-150608567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150588904 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 178 (K178N)
Ref Sequence ENSEMBL: ENSMUSP00000040840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046399]
Predicted Effect probably benign
Transcript: ENSMUST00000046399
AA Change: K178N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040840
Gene: ENSMUSG00000033096
AA Change: K178N

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Pfam:SGL 101 327 1.4e-17 PFAM
Pfam:Str_synth 200 288 1.2e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,782,416 C5S probably damaging Het
Actl6a G A 3: 32,719,955 D275N probably benign Het
Ahctf1 C A 1: 179,780,865 E681* probably null Het
Ankub1 G A 3: 57,692,285 S21L probably benign Het
Arhgap15 T A 2: 44,243,118 N345K probably damaging Het
Armc8 A G 9: 99,520,485 V379A probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
Atp5h T C 11: 115,416,863 E94G possibly damaging Het
B3gnt3 G A 8: 71,693,501 T128M probably damaging Het
Ccdc88c T A 12: 100,940,135 T1040S probably damaging Het
Crot C T 5: 8,978,208 R247Q probably benign Het
Dcaf8 T C 1: 172,193,860 W540R probably benign Het
Galnt11 T C 5: 25,250,224 I186T possibly damaging Het
Gne T A 4: 44,072,911 probably benign Het
Gpr37 A T 6: 25,688,202 F299I probably benign Het
Gpr37l1 C T 1: 135,167,429 A26T probably benign Het
Grm4 A G 17: 27,438,791 Y414H probably damaging Het
Kcnh1 T C 1: 192,506,012 I954T possibly damaging Het
Lias T C 5: 65,404,209 Y308H probably damaging Het
Lrrc8a C T 2: 30,256,607 H478Y probably benign Het
Mug1 T A 6: 121,871,381 I688K probably benign Het
Nrp1 A G 8: 128,480,939 D605G probably benign Het
Nt5dc3 A G 10: 86,833,999 Y486C possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,649 C241* probably null Het
Olfr1413 T A 1: 92,573,399 V76D possibly damaging Het
Olfr285 A T 15: 98,313,073 L159H probably damaging Het
Pcolce A G 5: 137,611,288 L14P probably damaging Het
Pcsk6 T C 7: 65,931,733 I254T probably benign Het
Pdzrn3 A T 6: 101,151,606 C700S probably damaging Het
Pglyrp2 A G 17: 32,416,002 F462S probably damaging Het
Pla2g16 T A 19: 7,574,982 Y21N possibly damaging Het
Plekhm1 A T 11: 103,394,952 L219Q probably damaging Het
Prkch T A 12: 73,585,244 S28T possibly damaging Het
Prrc2c A T 1: 162,679,512 S2529R possibly damaging Het
Prss3 G T 6: 41,373,893 A221D probably damaging Het
Retreg1 T C 15: 25,968,407 L83S probably damaging Het
Slc25a47 T A 12: 108,854,321 F84I probably benign Het
Sntb2 A G 8: 107,001,688 I423V probably benign Het
Spg20 A T 3: 55,124,879 D378V possibly damaging Het
Spint2 A T 7: 29,259,410 F127Y probably damaging Het
Stag3 A G 5: 138,311,788 T1233A probably benign Het
Tenm3 A G 8: 48,349,356 I390T probably benign Het
Tigd2 A G 6: 59,210,199 D17G probably damaging Het
Tln2 C A 9: 67,272,654 A812S probably benign Het
Tmem234 A G 4: 129,607,524 T133A probably benign Het
Tsr1 A G 11: 74,903,826 S436G probably benign Het
Ttn T C 2: 76,710,688 I33985V probably benign Het
Usp34 A C 11: 23,444,184 D2278A Het
Vav3 T A 3: 109,657,969 F727Y probably benign Het
Vcl T C 14: 21,010,168 probably null Het
Vps13c T A 9: 67,973,403 D3507E probably damaging Het
Zfp319 A G 8: 95,328,310 S422P possibly damaging Het
Other mutations in Apmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03135:Apmap APN 2 150587115 missense possibly damaging 0.89
R0898:Apmap UTSW 2 150585749 splice site probably benign
R2267:Apmap UTSW 2 150588901 critical splice donor site probably null
R4171:Apmap UTSW 2 150584067 missense probably benign 0.01
R5456:Apmap UTSW 2 150590069 missense probably benign 0.00
R5815:Apmap UTSW 2 150600251 missense probably benign 0.00
R5838:Apmap UTSW 2 150585857 missense probably damaging 1.00
R5846:Apmap UTSW 2 150608421 missense probably damaging 0.99
R6117:Apmap UTSW 2 150600332 missense probably benign 0.13
R6899:Apmap UTSW 2 150594308 missense probably benign 0.07
R8527:Apmap UTSW 2 150586465 missense probably benign 0.21
R8542:Apmap UTSW 2 150586465 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCAGTGGCTAAAATACAGATGC -3'
(R):5'- GCACAGGTAGACTCTTGGAG -3'

Sequencing Primer
(F):5'- TGGCTAAAATACAGATGCTGGAG -3'
(R):5'- AGGTAGACTCTTGGAGCAGCC -3'
Posted On2021-03-08