Incidental Mutation 'R8734:Gne'
ID662907
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8734 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 44072911 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000128439] [ENSMUST00000133709] [ENSMUST00000140724] [ENSMUST00000144985] [ENSMUST00000173383]
Predicted Effect probably benign
Transcript: ENSMUST00000030201
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102936
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128439
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect probably benign
Transcript: ENSMUST00000140724
Predicted Effect probably benign
Transcript: ENSMUST00000144985
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173383
SMART Domains Protein: ENSMUSP00000133440
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 133 3.9e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,782,416 C5S probably damaging Het
Actl6a G A 3: 32,719,955 D275N probably benign Het
Ahctf1 C A 1: 179,780,865 E681* probably null Het
Ankub1 G A 3: 57,692,285 S21L probably benign Het
Apmap T A 2: 150,588,904 K178N probably benign Het
Arhgap15 T A 2: 44,243,118 N345K probably damaging Het
Armc8 A G 9: 99,520,485 V379A probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
Atp5h T C 11: 115,416,863 E94G possibly damaging Het
B3gnt3 G A 8: 71,693,501 T128M probably damaging Het
Ccdc88c T A 12: 100,940,135 T1040S probably damaging Het
Crot C T 5: 8,978,208 R247Q probably benign Het
Cyp2b9 A G 7: 26,198,610 probably benign Het
Dcaf8 T C 1: 172,193,860 W540R probably benign Het
Galnt11 T C 5: 25,250,224 I186T possibly damaging Het
Gpr37 A T 6: 25,688,202 F299I probably benign Het
Gpr37l1 C T 1: 135,167,429 A26T probably benign Het
Grm4 A G 17: 27,438,791 Y414H probably damaging Het
Kcnh1 T C 1: 192,506,012 I954T possibly damaging Het
Lias T C 5: 65,404,209 Y308H probably damaging Het
Lrrc27 T A 7: 139,216,599 probably benign Het
Lrrc8a C T 2: 30,256,607 H478Y probably benign Het
Mdh2 T A 5: 135,784,129 probably benign Het
Mug1 T A 6: 121,871,381 I688K probably benign Het
Nrp1 A G 8: 128,480,939 D605G probably benign Het
Nt5dc3 A G 10: 86,833,999 Y486C possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,649 C241* probably null Het
Olfr1413 T A 1: 92,573,399 V76D possibly damaging Het
Olfr285 A T 15: 98,313,073 L159H probably damaging Het
Pam A T 1: 97,834,402 probably benign Het
Pcolce A G 5: 137,611,288 L14P probably damaging Het
Pcsk6 T C 7: 65,931,733 I254T probably benign Het
Pdzrn3 A T 6: 101,151,606 C700S probably damaging Het
Pglyrp2 A G 17: 32,416,002 F462S probably damaging Het
Pla2g16 T A 19: 7,574,982 Y21N possibly damaging Het
Plekhm1 A T 11: 103,394,952 L219Q probably damaging Het
Prkch T A 12: 73,585,244 S28T possibly damaging Het
Prrc2c A T 1: 162,679,512 S2529R possibly damaging Het
Prss3 G T 6: 41,373,893 A221D probably damaging Het
Rbm33 T A 5: 28,352,876 probably benign Het
Retreg1 T C 15: 25,968,407 L83S probably damaging Het
Robo2 C T 16: 73,967,763 probably benign Het
Slc25a47 T A 12: 108,854,321 F84I probably benign Het
Sntb2 A G 8: 107,001,688 I423V probably benign Het
Spg20 A T 3: 55,124,879 D378V possibly damaging Het
Spint2 A T 7: 29,259,410 F127Y probably damaging Het
Stag3 A G 5: 138,311,788 T1233A probably benign Het
Tenm3 A G 8: 48,349,356 I390T probably benign Het
Tigd2 A G 6: 59,210,199 D17G probably damaging Het
Tln2 C A 9: 67,272,654 A812S probably benign Het
Tmem234 A G 4: 129,607,524 T133A probably benign Het
Trnp1 A G 4: 133,498,069 F130S possibly damaging Het
Tsr1 A G 11: 74,903,826 S436G probably benign Het
Ttn T C 2: 76,710,688 I33985V probably benign Het
Usp34 A C 11: 23,444,184 D2278A Het
Vav3 T A 3: 109,657,969 F727Y probably benign Het
Vcl T C 14: 21,010,168 probably null Het
Vps13c T A 9: 67,973,403 D3507E probably damaging Het
Vtn A G 11: 78,500,264 probably benign Het
Zfp319 A G 8: 95,328,310 S422P possibly damaging Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 splice site probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
R7170:Gne UTSW 4 44040361 missense possibly damaging 0.95
R7191:Gne UTSW 4 44040266 missense probably benign 0.16
R7264:Gne UTSW 4 44042175 missense probably damaging 0.96
R7413:Gne UTSW 4 44044857 missense probably benign 0.06
R7956:Gne UTSW 4 44044962 missense probably benign 0.32
R8184:Gne UTSW 4 44084061 missense probably benign 0.07
RF012:Gne UTSW 4 44060045 missense probably damaging 1.00
RF014:Gne UTSW 4 44060045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCGTGAGTCACCGAC -3'
(R):5'- ATGTGTATTGTCACGCTGCACTC -3'

Sequencing Primer
(F):5'- TCACCGACTGACTCGTGG -3'
(R):5'- TCAGCCAGAGCCTCGTG -3'
Posted On2021-03-08