Incidental Mutation 'R8734:Nrp1'
ID662926
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8734 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128480939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 605 (D605G)
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026917
AA Change: D605G

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: D605G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,782,416 C5S probably damaging Het
Actl6a G A 3: 32,719,955 D275N probably benign Het
Ahctf1 C A 1: 179,780,865 E681* probably null Het
Ankub1 G A 3: 57,692,285 S21L probably benign Het
Apmap T A 2: 150,588,904 K178N probably benign Het
Arhgap15 T A 2: 44,243,118 N345K probably damaging Het
Armc8 A G 9: 99,520,485 V379A probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
Atp5h T C 11: 115,416,863 E94G possibly damaging Het
B3gnt3 G A 8: 71,693,501 T128M probably damaging Het
Ccdc88c T A 12: 100,940,135 T1040S probably damaging Het
Crot C T 5: 8,978,208 R247Q probably benign Het
Cyp2b9 A G 7: 26,198,610 probably benign Het
Dcaf8 T C 1: 172,193,860 W540R probably benign Het
Galnt11 T C 5: 25,250,224 I186T possibly damaging Het
Gne T A 4: 44,072,911 probably benign Het
Gpr37 A T 6: 25,688,202 F299I probably benign Het
Gpr37l1 C T 1: 135,167,429 A26T probably benign Het
Grm4 A G 17: 27,438,791 Y414H probably damaging Het
Kcnh1 T C 1: 192,506,012 I954T possibly damaging Het
Lias T C 5: 65,404,209 Y308H probably damaging Het
Lrrc27 T A 7: 139,216,599 probably benign Het
Lrrc8a C T 2: 30,256,607 H478Y probably benign Het
Mdh2 T A 5: 135,784,129 probably benign Het
Mug1 T A 6: 121,871,381 I688K probably benign Het
Nt5dc3 A G 10: 86,833,999 Y486C possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,649 C241* probably null Het
Olfr1413 T A 1: 92,573,399 V76D possibly damaging Het
Olfr285 A T 15: 98,313,073 L159H probably damaging Het
Pam A T 1: 97,834,402 probably benign Het
Pcolce A G 5: 137,611,288 L14P probably damaging Het
Pcsk6 T C 7: 65,931,733 I254T probably benign Het
Pdzrn3 A T 6: 101,151,606 C700S probably damaging Het
Pglyrp2 A G 17: 32,416,002 F462S probably damaging Het
Pla2g16 T A 19: 7,574,982 Y21N possibly damaging Het
Plekhm1 A T 11: 103,394,952 L219Q probably damaging Het
Prkch T A 12: 73,585,244 S28T possibly damaging Het
Prrc2c A T 1: 162,679,512 S2529R possibly damaging Het
Prss3 G T 6: 41,373,893 A221D probably damaging Het
Rbm33 T A 5: 28,352,876 probably benign Het
Retreg1 T C 15: 25,968,407 L83S probably damaging Het
Robo2 C T 16: 73,967,763 probably benign Het
Slc25a47 T A 12: 108,854,321 F84I probably benign Het
Sntb2 A G 8: 107,001,688 I423V probably benign Het
Spg20 A T 3: 55,124,879 D378V possibly damaging Het
Spint2 A T 7: 29,259,410 F127Y probably damaging Het
Stag3 A G 5: 138,311,788 T1233A probably benign Het
Tenm3 A G 8: 48,349,356 I390T probably benign Het
Tigd2 A G 6: 59,210,199 D17G probably damaging Het
Tln2 C A 9: 67,272,654 A812S probably benign Het
Tmem234 A G 4: 129,607,524 T133A probably benign Het
Trnp1 A G 4: 133,498,069 F130S possibly damaging Het
Tsr1 A G 11: 74,903,826 S436G probably benign Het
Ttn T C 2: 76,710,688 I33985V probably benign Het
Usp34 A C 11: 23,444,184 D2278A Het
Vav3 T A 3: 109,657,969 F727Y probably benign Het
Vcl T C 14: 21,010,168 probably null Het
Vps13c T A 9: 67,973,403 D3507E probably damaging Het
Vtn A G 11: 78,500,264 probably benign Het
Zfp319 A G 8: 95,328,310 S422P possibly damaging Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0046:Nrp1 UTSW 8 128500608 splice site probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0403:Nrp1 UTSW 8 128457969 missense probably damaging 1.00
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2047:Nrp1 UTSW 8 128498096 splice site probably benign
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3405:Nrp1 UTSW 8 128498088 nonsense probably null
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4379:Nrp1 UTSW 8 128468467 missense probably damaging 1.00
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R6889:Nrp1 UTSW 8 128493057 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
R8088:Nrp1 UTSW 8 128468516 nonsense probably null
R8193:Nrp1 UTSW 8 128460706 missense probably damaging 1.00
R8206:Nrp1 UTSW 8 128457957 missense probably damaging 0.99
R8245:Nrp1 UTSW 8 128487953 missense probably benign
R8684:Nrp1 UTSW 8 128359404 start gained probably benign
R8875:Nrp1 UTSW 8 128480991 critical splice donor site probably null
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Z1186:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Z1189:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Z1192:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAGTATTCCCGAGAGAG -3'
(R):5'- CAGCCACCAGGAGTAATTGG -3'

Sequencing Primer
(F):5'- AGAGGCGGAACATGTCCCTG -3'
(R):5'- CAGCCACCAGGAGTAATTGGTTTAC -3'
Posted On2021-03-08