Incidental Mutation 'R8734:Tln2'
ID662927
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R8734 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67272654 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 812 (A812S)
Ref Sequence ENSEMBL: ENSMUSP00000149474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]
Predicted Effect probably damaging
Transcript: ENSMUST00000039662
AA Change: A1898S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: A1898S

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040025
AA Change: A1898S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: A1898S

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214859
Predicted Effect possibly damaging
Transcript: ENSMUST00000215267
AA Change: A808S

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000215784
AA Change: A1900S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000217550
AA Change: A812S

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.5250 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,782,416 C5S probably damaging Het
Actl6a G A 3: 32,719,955 D275N probably benign Het
Ahctf1 C A 1: 179,780,865 E681* probably null Het
Ankub1 G A 3: 57,692,285 S21L probably benign Het
Apmap T A 2: 150,588,904 K178N probably benign Het
Arhgap15 T A 2: 44,243,118 N345K probably damaging Het
Armc8 A G 9: 99,520,485 V379A probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
Atp5h T C 11: 115,416,863 E94G possibly damaging Het
B3gnt3 G A 8: 71,693,501 T128M probably damaging Het
Ccdc88c T A 12: 100,940,135 T1040S probably damaging Het
Crot C T 5: 8,978,208 R247Q probably benign Het
Cyp2b9 A G 7: 26,198,610 probably benign Het
Dcaf8 T C 1: 172,193,860 W540R probably benign Het
Galnt11 T C 5: 25,250,224 I186T possibly damaging Het
Gne T A 4: 44,072,911 probably benign Het
Gpr37 A T 6: 25,688,202 F299I probably benign Het
Gpr37l1 C T 1: 135,167,429 A26T probably benign Het
Grm4 A G 17: 27,438,791 Y414H probably damaging Het
Kcnh1 T C 1: 192,506,012 I954T possibly damaging Het
Lias T C 5: 65,404,209 Y308H probably damaging Het
Lrrc27 T A 7: 139,216,599 probably benign Het
Lrrc8a C T 2: 30,256,607 H478Y probably benign Het
Mdh2 T A 5: 135,784,129 probably benign Het
Mug1 T A 6: 121,871,381 I688K probably benign Het
Nrp1 A G 8: 128,480,939 D605G probably benign Het
Nt5dc3 A G 10: 86,833,999 Y486C possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,649 C241* probably null Het
Olfr1413 T A 1: 92,573,399 V76D possibly damaging Het
Olfr285 A T 15: 98,313,073 L159H probably damaging Het
Pam A T 1: 97,834,402 probably benign Het
Pcolce A G 5: 137,611,288 L14P probably damaging Het
Pcsk6 T C 7: 65,931,733 I254T probably benign Het
Pdzrn3 A T 6: 101,151,606 C700S probably damaging Het
Pglyrp2 A G 17: 32,416,002 F462S probably damaging Het
Pla2g16 T A 19: 7,574,982 Y21N possibly damaging Het
Plekhm1 A T 11: 103,394,952 L219Q probably damaging Het
Prkch T A 12: 73,585,244 S28T possibly damaging Het
Prrc2c A T 1: 162,679,512 S2529R possibly damaging Het
Prss3 G T 6: 41,373,893 A221D probably damaging Het
Rbm33 T A 5: 28,352,876 probably benign Het
Retreg1 T C 15: 25,968,407 L83S probably damaging Het
Robo2 C T 16: 73,967,763 probably benign Het
Slc25a47 T A 12: 108,854,321 F84I probably benign Het
Sntb2 A G 8: 107,001,688 I423V probably benign Het
Spg20 A T 3: 55,124,879 D378V possibly damaging Het
Spint2 A T 7: 29,259,410 F127Y probably damaging Het
Stag3 A G 5: 138,311,788 T1233A probably benign Het
Tenm3 A G 8: 48,349,356 I390T probably benign Het
Tigd2 A G 6: 59,210,199 D17G probably damaging Het
Tmem234 A G 4: 129,607,524 T133A probably benign Het
Trnp1 A G 4: 133,498,069 F130S possibly damaging Het
Tsr1 A G 11: 74,903,826 S436G probably benign Het
Ttn T C 2: 76,710,688 I33985V probably benign Het
Usp34 A C 11: 23,444,184 D2278A Het
Vav3 T A 3: 109,657,969 F727Y probably benign Het
Vcl T C 14: 21,010,168 probably null Het
Vps13c T A 9: 67,973,403 D3507E probably damaging Het
Vtn A G 11: 78,500,264 probably benign Het
Zfp319 A G 8: 95,328,310 S422P possibly damaging Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
BB008:Tln2 UTSW 9 67258460 critical splice donor site probably null
BB018:Tln2 UTSW 9 67258460 critical splice donor site probably null
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
R7015:Tln2 UTSW 9 67362647 missense possibly damaging 0.55
R7051:Tln2 UTSW 9 67346417 missense probably benign 0.00
R7246:Tln2 UTSW 9 67262979 missense probably damaging 1.00
R7292:Tln2 UTSW 9 67346461 missense probably benign
R7753:Tln2 UTSW 9 67395473 missense probably damaging 1.00
R7868:Tln2 UTSW 9 67348226 missense probably damaging 1.00
R7931:Tln2 UTSW 9 67258460 critical splice donor site probably null
R8023:Tln2 UTSW 9 67224064 missense probably damaging 1.00
R8081:Tln2 UTSW 9 67356747 missense probably damaging 1.00
R8164:Tln2 UTSW 9 67319420 missense probably benign 0.31
R8192:Tln2 UTSW 9 67346529 nonsense probably null
R8495:Tln2 UTSW 9 67354467 missense probably benign 0.01
R8739:Tln2 UTSW 9 67258273 missense probably damaging 1.00
R8757:Tln2 UTSW 9 67367218 missense probably damaging 1.00
R8759:Tln2 UTSW 9 67367218 missense probably damaging 1.00
R8770:Tln2 UTSW 9 67323022 missense probably benign
R8781:Tln2 UTSW 9 67255951 missense probably damaging 1.00
R8812:Tln2 UTSW 9 67221411 missense possibly damaging 0.75
R8814:Tln2 UTSW 9 67221411 missense possibly damaging 0.75
R8816:Tln2 UTSW 9 67221411 missense possibly damaging 0.75
R8816:Tln2 UTSW 9 67221517 missense probably damaging 1.00
R8833:Tln2 UTSW 9 67221411 missense possibly damaging 0.75
R8837:Tln2 UTSW 9 67250584 missense probably damaging 0.99
R8843:Tln2 UTSW 9 67395545 missense probably damaging 1.00
R8864:Tln2 UTSW 9 67330552 nonsense probably null
R8867:Tln2 UTSW 9 67330550 missense probably damaging 0.98
R8921:Tln2 UTSW 9 67266823 missense probably damaging 0.99
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Z1176:Tln2 UTSW 9 67346485 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AATGGGGAATGAAACCTGCTC -3'
(R):5'- TCCAGCCATTATGCTAGGCC -3'

Sequencing Primer
(F):5'- GAATGAAACCTGCTCCTGGCTC -3'
(R):5'- TTCCCCAGGGGCTAAAAGG -3'
Posted On2021-03-08