Incidental Mutation 'R8734:Abcc2'
ID 662944
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms multidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8734 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43782192-43840740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43782416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 5 (C5S)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect probably damaging
Transcript: ENSMUST00000026208
AA Change: C5S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: C5S

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,719,955 D275N probably benign Het
Ahctf1 C A 1: 179,780,865 E681* probably null Het
Ankub1 G A 3: 57,692,285 S21L probably benign Het
Apmap T A 2: 150,588,904 K178N probably benign Het
Arhgap15 T A 2: 44,243,118 N345K probably damaging Het
Armc8 A G 9: 99,520,485 V379A probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
Atp5h T C 11: 115,416,863 E94G possibly damaging Het
B3gnt3 G A 8: 71,693,501 T128M probably damaging Het
Ccdc88c T A 12: 100,940,135 T1040S probably damaging Het
Crot C T 5: 8,978,208 R247Q probably benign Het
Cyp2b9 A G 7: 26,198,610 probably benign Het
Dcaf8 T C 1: 172,193,860 W540R probably benign Het
Galnt11 T C 5: 25,250,224 I186T possibly damaging Het
Gne T A 4: 44,072,911 probably benign Het
Gpr37 A T 6: 25,688,202 F299I probably benign Het
Gpr37l1 C T 1: 135,167,429 A26T probably benign Het
Grm4 A G 17: 27,438,791 Y414H probably damaging Het
Kcnh1 T C 1: 192,506,012 I954T possibly damaging Het
Lias T C 5: 65,404,209 Y308H probably damaging Het
Lrrc27 T A 7: 139,216,599 probably benign Het
Lrrc8a C T 2: 30,256,607 H478Y probably benign Het
Mdh2 T A 5: 135,784,129 probably benign Het
Mug1 T A 6: 121,871,381 I688K probably benign Het
Nrp1 A G 8: 128,480,939 D605G probably benign Het
Nt5dc3 A G 10: 86,833,999 Y486C possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,649 C241* probably null Het
Olfr1413 T A 1: 92,573,399 V76D possibly damaging Het
Olfr285 A T 15: 98,313,073 L159H probably damaging Het
Pam A T 1: 97,834,402 probably benign Het
Pcolce A G 5: 137,611,288 L14P probably damaging Het
Pcsk6 T C 7: 65,931,733 I254T probably benign Het
Pdzrn3 A T 6: 101,151,606 C700S probably damaging Het
Pglyrp2 A G 17: 32,416,002 F462S probably damaging Het
Pla2g16 T A 19: 7,574,982 Y21N possibly damaging Het
Plekhm1 A T 11: 103,394,952 L219Q probably damaging Het
Prkch T A 12: 73,585,244 S28T possibly damaging Het
Prrc2c A T 1: 162,679,512 S2529R possibly damaging Het
Prss3 G T 6: 41,373,893 A221D probably damaging Het
Rbm33 T A 5: 28,352,876 probably benign Het
Retreg1 T C 15: 25,968,407 L83S probably damaging Het
Robo2 C T 16: 73,967,763 probably benign Het
Slc25a47 T A 12: 108,854,321 F84I probably benign Het
Sntb2 A G 8: 107,001,688 I423V probably benign Het
Spg20 A T 3: 55,124,879 D378V possibly damaging Het
Spint2 A T 7: 29,259,410 F127Y probably damaging Het
Stag3 A G 5: 138,311,788 T1233A probably benign Het
Tenm3 A G 8: 48,349,356 I390T probably benign Het
Tigd2 A G 6: 59,210,199 D17G probably damaging Het
Tln2 C A 9: 67,272,654 A812S probably benign Het
Tmem234 A G 4: 129,607,524 T133A probably benign Het
Trnp1 A G 4: 133,498,069 F130S possibly damaging Het
Tsr1 A G 11: 74,903,826 S436G probably benign Het
Ttn T C 2: 76,710,688 I33985V probably benign Het
Usp34 A C 11: 23,444,184 D2278A Het
Vav3 T A 3: 109,657,969 F727Y probably benign Het
Vcl T C 14: 21,010,168 probably null Het
Vps13c T A 9: 67,973,403 D3507E probably damaging Het
Vtn A G 11: 78,500,264 probably benign Het
Zfp319 A G 8: 95,328,310 S422P possibly damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
R8889:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43808662 missense probably benign 0.35
R9031:Abcc2 UTSW 19 43822027 missense probably benign
R9116:Abcc2 UTSW 19 43804952 missense probably benign 0.30
R9201:Abcc2 UTSW 19 43798441 missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43798443 missense probably benign 0.01
R9345:Abcc2 UTSW 19 43819430 missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43818032 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTGCTCACTGGGATGAC -3'
(R):5'- TTTCCCACGTGTTATAATCATGTGG -3'

Sequencing Primer
(F):5'- GCTCACTGGGATGACATAGCATTC -3'
(R):5'- ACCGGTTCATACCGATAG -3'
Posted On 2021-03-08