Incidental Mutation 'R8735:Smyd3'
ID662949
Institutional Source Beutler Lab
Gene Symbol Smyd3
Ensembl Gene ENSMUSG00000055067
Gene NameSET and MYND domain containing 3
Synonyms2410008A19Rik, Zmynd1
Accession Numbers

Genbank: NM_027188; MGI: 1916976; Ensembl: ENSMUST00000128302, ENSMUST00000111134, ENSMUST00000111133

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8735 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location178951960-179518041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 179092917 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 217 (N217K)
Ref Sequence ENSEMBL: ENSMUSP00000117410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128302]
Predicted Effect probably benign
Transcript: ENSMUST00000128302
AA Change: N217K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117410
Gene: ENSMUSG00000055067
AA Change: N217K

DomainStartEndE-ValueType
SET 4 246 1.04e-11 SMART
low complexity region 410 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which functions in RNA polymerase II complexes by an interaction with a specific RNA helicase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted, other(5) Gene trapped(29)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,154,486 probably null Het
6430550D23Rik A G 2: 156,003,811 F9S unknown Het
Abhd10 A G 16: 45,737,634 F101L probably damaging Het
Acp2 A G 2: 91,204,306 T93A probably benign Het
Ank3 A T 10: 69,986,955 T485S probably benign Het
Caly G A 7: 140,072,590 R82C probably damaging Het
Cfhr2 A G 1: 139,858,605 L8P probably damaging Het
Cpeb2 T A 5: 43,281,432 L869* probably null Het
Cxxc1 A G 18: 74,217,260 K33E possibly damaging Het
Cyp17a1 T C 19: 46,671,094 probably null Het
Cyp4a30b G A 4: 115,452,779 W59* probably null Het
Dennd4b T C 3: 90,277,865 V1204A probably damaging Het
Dpyd T A 3: 119,141,916 D663E possibly damaging Het
Exoc2 A C 13: 30,906,839 L261V probably damaging Het
Exosc9 T C 3: 36,555,513 L185S probably damaging Het
Gcnt3 T C 9: 70,034,446 K280R probably benign Het
Gm35339 T C 15: 76,356,575 Y488H Het
Ighv1-64 A T 12: 115,507,597 M100K probably benign Het
Impdh2 G A 9: 108,564,779 probably null Het
Itsn2 T A 12: 4,671,474 I1068K probably damaging Het
Kif5c T C 2: 49,694,771 C169R probably damaging Het
Kndc1 A G 7: 139,910,214 S211G probably benign Het
Lama2 T A 10: 27,190,534 E1117V probably damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lsg1 T A 16: 30,581,047 probably null Het
Msh3 A G 13: 92,274,866 S608P possibly damaging Het
Mslnl T A 17: 25,745,088 F464I probably benign Het
Mycbp2 T A 14: 103,223,150 K1493N probably damaging Het
Myo15 A T 11: 60,510,853 probably null Het
Myo1b A T 1: 51,755,737 F1065I probably benign Het
Nup153 C A 13: 46,727,551 probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr1447 A G 19: 12,900,910 V290A possibly damaging Het
Osbpl7 A G 11: 97,052,368 T149A probably benign Het
Parp1 A G 1: 180,569,125 D31G probably benign Het
Pcdha6 T A 18: 36,968,150 V132E possibly damaging Het
Pcdhb8 T A 18: 37,356,922 L551Q possibly damaging Het
Pcsk9 T A 4: 106,454,611 T190S probably damaging Het
Pdgfrb A T 18: 61,063,977 T162S probably benign Het
Pi4ka C T 16: 17,318,370 R908Q Het
Pnpla8 A G 12: 44,283,439 E258G probably benign Het
Prrc2c A T 1: 162,709,558 S643T unknown Het
Rnf20 T G 4: 49,655,964 I970S possibly damaging Het
Robo2 A T 16: 73,958,359 V758D probably damaging Het
Robo4 G A 9: 37,408,281 S609N possibly damaging Het
Rrbp1 G A 2: 143,989,000 Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Ryr2 C A 13: 11,686,947 E2941D probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Sh3rf1 G A 8: 61,372,653 V561I probably benign Het
Slc4a4 T A 5: 89,132,442 D366E probably damaging Het
Slfn14 T G 11: 83,283,889 Q92P probably damaging Het
Slfn4 A T 11: 83,186,944 Y186F probably damaging Het
Smpd4 T C 16: 17,635,546 L309P possibly damaging Het
Spen T C 4: 141,469,818 T3547A probably benign Het
Suclg1 A T 6: 73,276,746 I126F unknown Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmprss15 A T 16: 79,001,814 I660N possibly damaging Het
Trf A T 9: 103,210,524 V677D probably damaging Het
Trim36 T C 18: 46,169,385 N532S probably benign Het
Trim37 T C 11: 87,147,059 probably null Het
Ttn T C 2: 76,740,110 N26813S probably benign Het
Vmn1r199 T A 13: 22,383,367 V277D probably damaging Het
Wdfy3 T C 5: 101,930,085 D873G probably benign Het
Wdr27 T C 17: 14,883,667 T726A probably damaging Het
Wdtc1 A T 4: 133,304,200 C236* probably null Het
Wnk4 A C 11: 101,276,266 S1083R unknown Het
Wwc1 A T 11: 35,883,407 I342N probably damaging Het
Zbtb40 A G 4: 136,998,646 L534P probably damaging Het
Zfp62 T C 11: 49,217,400 C773R probably damaging Het
Zfp709 T A 8: 71,889,183 I152N probably benign Het
Zfp738 T C 13: 67,671,431 Y147C probably damaging Het
Zscan18 A C 7: 12,769,698 S645A probably benign Het
Zw10 A G 9: 49,077,561 Y709C probably damaging Het
Other mutations in Smyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Smyd3 APN 1 178972279 missense probably benign
IGL03088:Smyd3 APN 1 179094333 critical splice donor site probably null
D3080:Smyd3 UTSW 1 179086422 missense probably damaging 1.00
R0165:Smyd3 UTSW 1 179043872 missense probably benign
R0230:Smyd3 UTSW 1 179423428 splice site probably benign
R0390:Smyd3 UTSW 1 178957573 splice site probably benign
R1651:Smyd3 UTSW 1 179043876 missense probably benign
R4651:Smyd3 UTSW 1 179043741 missense probably benign 0.08
R4771:Smyd3 UTSW 1 179094396 missense probably damaging 0.99
R5326:Smyd3 UTSW 1 179410459 missense probably benign
R5542:Smyd3 UTSW 1 179410459 missense probably benign
R5697:Smyd3 UTSW 1 179411682 missense probably damaging 1.00
R5850:Smyd3 UTSW 1 179043855 missense probably damaging 1.00
R6732:Smyd3 UTSW 1 179395830 missense probably benign 0.01
R7782:Smyd3 UTSW 1 178972294 missense possibly damaging 0.94
R8065:Smyd3 UTSW 1 179410463 missense possibly damaging 0.60
R8067:Smyd3 UTSW 1 179410463 missense possibly damaging 0.60
R8236:Smyd3 UTSW 1 179405640 splice site probably null
X0024:Smyd3 UTSW 1 179050289 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATCTACAATTTGGTGTGTGACTG -3'
(R):5'- TGTAAGTGCTCCAAGACCCC -3'

Sequencing Primer
(F):5'- CTACAATTTGGTGTGTGACTGTTTTG -3'
(R):5'- GTGCTCCAAGACCCCAATCTTC -3'
Posted On2021-03-08