Incidental Mutation 'R8735:Dpyd'
ID 662959
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8735 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119141916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 663 (D663E)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect possibly damaging
Transcript: ENSMUST00000039177
AA Change: D663E

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: D663E

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,154,486 probably null Het
6430550D23Rik A G 2: 156,003,811 F9S unknown Het
Abhd10 A G 16: 45,737,634 F101L probably damaging Het
Acp2 A G 2: 91,204,306 T93A probably benign Het
Adamts9 C T 6: 92,860,067 probably benign Het
Aknad1 T A 3: 108,775,299 probably benign Het
Ank3 A T 10: 69,986,955 T485S probably benign Het
Caly G A 7: 140,072,590 R82C probably damaging Het
Cfhr2 A G 1: 139,858,605 L8P probably damaging Het
Cpeb2 T A 5: 43,281,432 L869* probably null Het
Cxxc1 A G 18: 74,217,260 K33E possibly damaging Het
Cyp17a1 T C 19: 46,671,094 probably null Het
Cyp4a30b G A 4: 115,452,779 W59* probably null Het
Dennd4b T C 3: 90,277,865 V1204A probably damaging Het
Esrrg A T 1: 188,201,008 probably benign Het
Exoc2 A C 13: 30,906,839 L261V probably damaging Het
Exosc9 T C 3: 36,555,513 L185S probably damaging Het
Gcnt3 T C 9: 70,034,446 K280R probably benign Het
Gm35339 T C 15: 76,356,575 Y488H Het
Ighv1-64 A T 12: 115,507,597 M100K probably benign Het
Impdh2 G A 9: 108,564,779 probably null Het
Itsn2 T A 12: 4,671,474 I1068K probably damaging Het
Kif5c T C 2: 49,694,771 C169R probably damaging Het
Kndc1 A G 7: 139,910,214 S211G probably benign Het
Lama2 T A 10: 27,190,534 E1117V probably damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lsg1 T A 16: 30,581,047 probably null Het
Msh3 A G 13: 92,274,866 S608P possibly damaging Het
Mslnl T A 17: 25,745,088 F464I probably benign Het
Mycbp2 T A 14: 103,223,150 K1493N probably damaging Het
Myo15 A T 11: 60,510,853 probably null Het
Myo1b A T 1: 51,755,737 F1065I probably benign Het
Nf1 A G 11: 79,454,310 probably benign Het
Nup153 C A 13: 46,727,551 probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr1447 A G 19: 12,900,910 V290A possibly damaging Het
Osbpl7 A G 11: 97,052,368 T149A probably benign Het
Parp1 A G 1: 180,569,125 D31G probably benign Het
Pcdha6 T A 18: 36,968,150 V132E possibly damaging Het
Pcdhb8 T A 18: 37,356,922 L551Q possibly damaging Het
Pcsk9 T A 4: 106,454,611 T190S probably damaging Het
Pdgfrb A T 18: 61,063,977 T162S probably benign Het
Pi4ka C T 16: 17,318,370 R908Q Het
Pnpla8 A G 12: 44,283,439 E258G probably benign Het
Prrc2c A T 1: 162,709,558 S643T unknown Het
Rnf20 T G 4: 49,655,964 I970S possibly damaging Het
Robo2 A T 16: 73,958,359 V758D probably damaging Het
Robo4 G A 9: 37,408,281 S609N possibly damaging Het
Rrbp1 G A 2: 143,989,000 Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Ryr2 C A 13: 11,686,947 E2941D probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Sh3rf1 G A 8: 61,372,653 V561I probably benign Het
Slc4a4 T A 5: 89,132,442 D366E probably damaging Het
Slfn14 T G 11: 83,283,889 Q92P probably damaging Het
Slfn4 A T 11: 83,186,944 Y186F probably damaging Het
Smpd4 T C 16: 17,635,546 L309P possibly damaging Het
Smyd3 G T 1: 179,092,917 N217K probably benign Het
Spen T C 4: 141,469,818 T3547A probably benign Het
Suclg1 A T 6: 73,276,746 I126F unknown Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmprss15 A T 16: 79,001,814 I660N possibly damaging Het
Trf A T 9: 103,210,524 V677D probably damaging Het
Trim36 T C 18: 46,169,385 N532S probably benign Het
Trim37 T C 11: 87,147,059 probably null Het
Ttn T C 2: 76,740,110 N26813S probably benign Het
Vmn1r199 T A 13: 22,383,367 V277D probably damaging Het
Wdfy3 T C 5: 101,930,085 D873G probably benign Het
Wdr27 T C 17: 14,883,667 T726A probably damaging Het
Wdtc1 A T 4: 133,304,200 C236* probably null Het
Wnk4 A C 11: 101,276,266 S1083R unknown Het
Wwc1 A T 11: 35,883,407 I342N probably damaging Het
Zbtb40 A G 4: 136,998,646 L534P probably damaging Het
Zfp62 T C 11: 49,217,400 C773R probably damaging Het
Zfp709 T A 8: 71,889,183 I152N probably benign Het
Zfp738 T C 13: 67,671,431 Y147C probably damaging Het
Zscan18 A C 7: 12,769,698 S645A probably benign Het
Zw10 A G 9: 49,077,561 Y709C probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCAGTTTCTACAGAAGTCGAAG -3'
(R):5'- CGTCTTCAGCCAGTCATCAG -3'

Sequencing Primer
(F):5'- TTCTACAGAAGTCGAAGCTATGTAGG -3'
(R):5'- TCTTCAGCCAGTCATCAGATCCAC -3'
Posted On 2021-03-08