Incidental Mutation 'R8735:Rnf20'
ID 662960
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8735 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 49655964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 970 (I970S)
Ref Sequence ENSEMBL: ENSMUSP00000029989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000029989
AA Change: I970S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: I970S

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167496
AA Change: I970S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: I970S

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,154,486 probably null Het
6430550D23Rik A G 2: 156,003,811 F9S unknown Het
Abhd10 A G 16: 45,737,634 F101L probably damaging Het
Acp2 A G 2: 91,204,306 T93A probably benign Het
Adamts9 C T 6: 92,860,067 probably benign Het
Aknad1 T A 3: 108,775,299 probably benign Het
Ank3 A T 10: 69,986,955 T485S probably benign Het
Caly G A 7: 140,072,590 R82C probably damaging Het
Cfhr2 A G 1: 139,858,605 L8P probably damaging Het
Cpeb2 T A 5: 43,281,432 L869* probably null Het
Cxxc1 A G 18: 74,217,260 K33E possibly damaging Het
Cyp17a1 T C 19: 46,671,094 probably null Het
Cyp4a30b G A 4: 115,452,779 W59* probably null Het
Dennd4b T C 3: 90,277,865 V1204A probably damaging Het
Dpyd T A 3: 119,141,916 D663E possibly damaging Het
Esrrg A T 1: 188,201,008 probably benign Het
Exoc2 A C 13: 30,906,839 L261V probably damaging Het
Exosc9 T C 3: 36,555,513 L185S probably damaging Het
Gcnt3 T C 9: 70,034,446 K280R probably benign Het
Gm35339 T C 15: 76,356,575 Y488H Het
Ighv1-64 A T 12: 115,507,597 M100K probably benign Het
Impdh2 G A 9: 108,564,779 probably null Het
Itsn2 T A 12: 4,671,474 I1068K probably damaging Het
Kif5c T C 2: 49,694,771 C169R probably damaging Het
Kndc1 A G 7: 139,910,214 S211G probably benign Het
Lama2 T A 10: 27,190,534 E1117V probably damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lsg1 T A 16: 30,581,047 probably null Het
Msh3 A G 13: 92,274,866 S608P possibly damaging Het
Mslnl T A 17: 25,745,088 F464I probably benign Het
Mycbp2 T A 14: 103,223,150 K1493N probably damaging Het
Myo15 A T 11: 60,510,853 probably null Het
Myo1b A T 1: 51,755,737 F1065I probably benign Het
Nf1 A G 11: 79,454,310 probably benign Het
Nup153 C A 13: 46,727,551 probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr1447 A G 19: 12,900,910 V290A possibly damaging Het
Osbpl7 A G 11: 97,052,368 T149A probably benign Het
Parp1 A G 1: 180,569,125 D31G probably benign Het
Pcdha6 T A 18: 36,968,150 V132E possibly damaging Het
Pcdhb8 T A 18: 37,356,922 L551Q possibly damaging Het
Pcsk9 T A 4: 106,454,611 T190S probably damaging Het
Pdgfrb A T 18: 61,063,977 T162S probably benign Het
Pi4ka C T 16: 17,318,370 R908Q Het
Pnpla8 A G 12: 44,283,439 E258G probably benign Het
Prrc2c A T 1: 162,709,558 S643T unknown Het
Robo2 A T 16: 73,958,359 V758D probably damaging Het
Robo4 G A 9: 37,408,281 S609N possibly damaging Het
Rrbp1 G A 2: 143,989,000 Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Ryr2 C A 13: 11,686,947 E2941D probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Sh3rf1 G A 8: 61,372,653 V561I probably benign Het
Slc4a4 T A 5: 89,132,442 D366E probably damaging Het
Slfn14 T G 11: 83,283,889 Q92P probably damaging Het
Slfn4 A T 11: 83,186,944 Y186F probably damaging Het
Smpd4 T C 16: 17,635,546 L309P possibly damaging Het
Smyd3 G T 1: 179,092,917 N217K probably benign Het
Spen T C 4: 141,469,818 T3547A probably benign Het
Suclg1 A T 6: 73,276,746 I126F unknown Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmprss15 A T 16: 79,001,814 I660N possibly damaging Het
Trf A T 9: 103,210,524 V677D probably damaging Het
Trim36 T C 18: 46,169,385 N532S probably benign Het
Trim37 T C 11: 87,147,059 probably null Het
Ttn T C 2: 76,740,110 N26813S probably benign Het
Vmn1r199 T A 13: 22,383,367 V277D probably damaging Het
Wdfy3 T C 5: 101,930,085 D873G probably benign Het
Wdr27 T C 17: 14,883,667 T726A probably damaging Het
Wdtc1 A T 4: 133,304,200 C236* probably null Het
Wnk4 A C 11: 101,276,266 S1083R unknown Het
Wwc1 A T 11: 35,883,407 I342N probably damaging Het
Zbtb40 A G 4: 136,998,646 L534P probably damaging Het
Zfp62 T C 11: 49,217,400 C773R probably damaging Het
Zfp709 T A 8: 71,889,183 I152N probably benign Het
Zfp738 T C 13: 67,671,431 Y147C probably damaging Het
Zscan18 A C 7: 12,769,698 S645A probably benign Het
Zw10 A G 9: 49,077,561 Y709C probably damaging Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGCACCACAGTTGCCTTG -3'
(R):5'- GGGAAGACAAACGCTAGTAATTTC -3'

Sequencing Primer
(F):5'- GGTTTATTTATAGTTCCTCAGGCAC -3'
(R):5'- TCTAGTTCATTCTAAGTCCCAAGAC -3'
Posted On 2021-03-08