Incidental Mutation 'R8735:Spen'
ID 662965
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission 068583-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8735 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141195201-141265908 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141197129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 3547 (T3547A)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078886
AA Change: T3524A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T3524A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
AA Change: T3547A

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T3547A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 155,845,731 (GRCm39) F9S unknown Het
Abhd10 A G 16: 45,557,997 (GRCm39) F101L probably damaging Het
Acp2 A G 2: 91,034,651 (GRCm39) T93A probably benign Het
Adamts9 C T 6: 92,837,048 (GRCm39) probably benign Het
Aknad1 T A 3: 108,682,615 (GRCm39) probably benign Het
Ank3 A T 10: 69,822,785 (GRCm39) T485S probably benign Het
Caly G A 7: 139,652,503 (GRCm39) R82C probably damaging Het
Cfhr2 A G 1: 139,786,343 (GRCm39) L8P probably damaging Het
Cpeb2 T A 5: 43,438,775 (GRCm39) L869* probably null Het
Cxxc1 A G 18: 74,350,331 (GRCm39) K33E possibly damaging Het
Cyp17a1 T C 19: 46,659,533 (GRCm39) probably null Het
Cyp4a30b G A 4: 115,309,976 (GRCm39) W59* probably null Het
Dennd4b T C 3: 90,185,172 (GRCm39) V1204A probably damaging Het
Dpyd T A 3: 118,935,565 (GRCm39) D663E possibly damaging Het
Esrrg A T 1: 187,933,205 (GRCm39) probably benign Het
Exoc2 A C 13: 31,090,822 (GRCm39) L261V probably damaging Het
Exosc9 T C 3: 36,609,662 (GRCm39) L185S probably damaging Het
Gcnt3 T C 9: 69,941,728 (GRCm39) K280R probably benign Het
Ighv1-64 A T 12: 115,471,217 (GRCm39) M100K probably benign Het
Impdh2 G A 9: 108,441,978 (GRCm39) probably null Het
Itsn2 T A 12: 4,721,474 (GRCm39) I1068K probably damaging Het
Kif5c T C 2: 49,584,783 (GRCm39) C169R probably damaging Het
Kndc1 A G 7: 139,490,130 (GRCm39) S211G probably benign Het
Lama2 T A 10: 27,066,530 (GRCm39) E1117V probably damaging Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lsg1 T A 16: 30,399,865 (GRCm39) probably null Het
Mab21l4 C T 1: 93,082,208 (GRCm39) probably null Het
Msh3 A G 13: 92,411,374 (GRCm39) S608P possibly damaging Het
Mslnl T A 17: 25,964,062 (GRCm39) F464I probably benign Het
Mycbp2 T A 14: 103,460,586 (GRCm39) K1493N probably damaging Het
Myo15a A T 11: 60,401,679 (GRCm39) probably null Het
Myo1b A T 1: 51,794,896 (GRCm39) F1065I probably benign Het
Nf1 A G 11: 79,345,136 (GRCm39) probably benign Het
Nup153 C A 13: 46,881,027 (GRCm39) probably benign Het
Or4f4-ps1 T A 2: 111,330,497 (GRCm39) I300K probably damaging Het
Or5b97 A G 19: 12,878,274 (GRCm39) V290A possibly damaging Het
Osbpl7 A G 11: 96,943,194 (GRCm39) T149A probably benign Het
Parp1 A G 1: 180,396,690 (GRCm39) D31G probably benign Het
Pcdha6 T A 18: 37,101,203 (GRCm39) V132E possibly damaging Het
Pcdhb8 T A 18: 37,489,975 (GRCm39) L551Q possibly damaging Het
Pcsk9 T A 4: 106,311,808 (GRCm39) T190S probably damaging Het
Pdgfrb A T 18: 61,197,049 (GRCm39) T162S probably benign Het
Pi4ka C T 16: 17,136,234 (GRCm39) R908Q Het
Pnpla8 A G 12: 44,330,222 (GRCm39) E258G probably benign Het
Prrc2c A T 1: 162,537,127 (GRCm39) S643T unknown Het
Rnf20 T G 4: 49,655,964 (GRCm39) I970S possibly damaging Het
Robo2 A T 16: 73,755,247 (GRCm39) V758D probably damaging Het
Robo4 G A 9: 37,319,577 (GRCm39) S609N possibly damaging Het
Rrbp1 G A 2: 143,830,920 (GRCm39) Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Ryr2 C A 13: 11,701,833 (GRCm39) E2941D probably damaging Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Sh3rf1 G A 8: 61,825,687 (GRCm39) V561I probably benign Het
Slc4a4 T A 5: 89,280,301 (GRCm39) D366E probably damaging Het
Slfn14 T G 11: 83,174,715 (GRCm39) Q92P probably damaging Het
Slfn4 A T 11: 83,077,770 (GRCm39) Y186F probably damaging Het
Smpd4 T C 16: 17,453,410 (GRCm39) L309P possibly damaging Het
Smyd3 G T 1: 178,920,482 (GRCm39) N217K probably benign Het
Suclg1 A T 6: 73,253,729 (GRCm39) I126F unknown Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmprss15 A T 16: 78,798,702 (GRCm39) I660N possibly damaging Het
Trf A T 9: 103,087,723 (GRCm39) V677D probably damaging Het
Trim36 T C 18: 46,302,452 (GRCm39) N532S probably benign Het
Trim37 T C 11: 87,037,885 (GRCm39) probably null Het
Ttn T C 2: 76,570,454 (GRCm39) N26813S probably benign Het
Vmn1r199 T A 13: 22,567,537 (GRCm39) V277D probably damaging Het
Wdfy3 T C 5: 102,077,951 (GRCm39) D873G probably benign Het
Wdr27 T C 17: 15,103,929 (GRCm39) T726A probably damaging Het
Wdr97 T C 15: 76,240,775 (GRCm39) Y488H Het
Wdtc1 A T 4: 133,031,511 (GRCm39) C236* probably null Het
Wnk4 A C 11: 101,167,092 (GRCm39) S1083R unknown Het
Wwc1 A T 11: 35,774,234 (GRCm39) I342N probably damaging Het
Zbtb40 A G 4: 136,725,957 (GRCm39) L534P probably damaging Het
Zfp62 T C 11: 49,108,227 (GRCm39) C773R probably damaging Het
Zfp709 T A 8: 72,643,027 (GRCm39) I152N probably benign Het
Zfp738 T C 13: 67,819,550 (GRCm39) Y147C probably damaging Het
Zscan18 A C 7: 12,503,625 (GRCm39) S645A probably benign Het
Zw10 A G 9: 48,988,861 (GRCm39) Y709C probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141,217,212 (GRCm39) missense unknown
IGL01357:Spen APN 4 141,244,424 (GRCm39) missense unknown
IGL02184:Spen APN 4 141,214,917 (GRCm39) missense unknown
IGL02226:Spen APN 4 141,205,457 (GRCm39) missense unknown
IGL02321:Spen APN 4 141,244,441 (GRCm39) missense unknown
IGL02350:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02357:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02627:Spen APN 4 141,200,326 (GRCm39) missense probably damaging 0.99
IGL02683:Spen APN 4 141,198,956 (GRCm39) missense probably benign 0.06
IGL02945:Spen APN 4 141,221,624 (GRCm39) missense unknown
IGL02950:Spen APN 4 141,196,819 (GRCm39) missense probably damaging 1.00
IGL03008:Spen APN 4 141,203,448 (GRCm39) missense possibly damaging 0.70
IGL03019:Spen APN 4 141,206,227 (GRCm39) missense unknown
IGL03038:Spen APN 4 141,265,550 (GRCm39) missense unknown
IGL03334:Spen APN 4 141,197,280 (GRCm39) missense probably damaging 1.00
filtered UTSW 4 141,204,683 (GRCm39) missense unknown
mentholated UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R0105:Spen UTSW 4 141,197,121 (GRCm39) splice site probably benign
R0268:Spen UTSW 4 141,204,868 (GRCm39) missense unknown
R0359:Spen UTSW 4 141,244,181 (GRCm39) missense unknown
R0394:Spen UTSW 4 141,201,514 (GRCm39) missense probably benign 0.03
R0423:Spen UTSW 4 141,206,647 (GRCm39) missense unknown
R0433:Spen UTSW 4 141,211,069 (GRCm39) missense unknown
R0462:Spen UTSW 4 141,200,962 (GRCm39) missense probably damaging 1.00
R0687:Spen UTSW 4 141,215,339 (GRCm39) missense unknown
R0699:Spen UTSW 4 141,201,702 (GRCm39) missense possibly damaging 0.72
R0865:Spen UTSW 4 141,199,181 (GRCm39) missense probably benign 0.11
R0918:Spen UTSW 4 141,212,875 (GRCm39) missense unknown
R1034:Spen UTSW 4 141,203,063 (GRCm39) missense probably benign 0.33
R1341:Spen UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R1401:Spen UTSW 4 141,199,132 (GRCm39) missense probably damaging 0.98
R1509:Spen UTSW 4 141,202,946 (GRCm39) missense probably benign 0.00
R1509:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R1561:Spen UTSW 4 141,199,694 (GRCm39) nonsense probably null
R1589:Spen UTSW 4 141,215,335 (GRCm39) missense unknown
R1640:Spen UTSW 4 141,196,254 (GRCm39) missense probably damaging 0.98
R1758:Spen UTSW 4 141,203,686 (GRCm39) missense unknown
R1764:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R1824:Spen UTSW 4 141,200,096 (GRCm39) missense probably damaging 1.00
R1899:Spen UTSW 4 141,197,654 (GRCm39) missense probably benign 0.17
R1916:Spen UTSW 4 141,199,909 (GRCm39) missense probably damaging 1.00
R2011:Spen UTSW 4 141,200,640 (GRCm39) missense probably damaging 1.00
R2295:Spen UTSW 4 141,204,584 (GRCm39) missense unknown
R2379:Spen UTSW 4 141,244,238 (GRCm39) missense unknown
R2404:Spen UTSW 4 141,205,216 (GRCm39) missense unknown
R3719:Spen UTSW 4 141,244,494 (GRCm39) missense unknown
R3889:Spen UTSW 4 141,205,192 (GRCm39) missense unknown
R3945:Spen UTSW 4 141,204,664 (GRCm39) missense unknown
R4227:Spen UTSW 4 141,249,458 (GRCm39) missense unknown
R4326:Spen UTSW 4 141,204,683 (GRCm39) missense unknown
R4382:Spen UTSW 4 141,200,450 (GRCm39) missense possibly damaging 0.88
R4542:Spen UTSW 4 141,204,097 (GRCm39) missense unknown
R4757:Spen UTSW 4 141,200,390 (GRCm39) nonsense probably null
R4771:Spen UTSW 4 141,199,907 (GRCm39) missense probably benign 0.14
R5072:Spen UTSW 4 141,249,613 (GRCm39) missense unknown
R5121:Spen UTSW 4 141,203,410 (GRCm39) missense probably benign 0.00
R5176:Spen UTSW 4 141,203,587 (GRCm39) missense unknown
R5290:Spen UTSW 4 141,201,127 (GRCm39) missense probably damaging 1.00
R5291:Spen UTSW 4 141,215,390 (GRCm39) missense unknown
R5293:Spen UTSW 4 141,199,717 (GRCm39) missense possibly damaging 0.89
R5347:Spen UTSW 4 141,198,796 (GRCm39) missense probably benign 0.26
R5511:Spen UTSW 4 141,244,149 (GRCm39) missense unknown
R5511:Spen UTSW 4 141,202,375 (GRCm39) missense possibly damaging 0.86
R5772:Spen UTSW 4 141,205,495 (GRCm39) missense unknown
R5834:Spen UTSW 4 141,199,154 (GRCm39) missense possibly damaging 0.63
R5858:Spen UTSW 4 141,201,182 (GRCm39) missense probably benign 0.05
R6214:Spen UTSW 4 141,206,423 (GRCm39) missense unknown
R6232:Spen UTSW 4 141,244,333 (GRCm39) missense unknown
R6345:Spen UTSW 4 141,198,944 (GRCm39) missense possibly damaging 0.86
R6419:Spen UTSW 4 141,203,621 (GRCm39) missense unknown
R6455:Spen UTSW 4 141,202,820 (GRCm39) missense probably damaging 0.97
R6979:Spen UTSW 4 141,205,374 (GRCm39) missense unknown
R6994:Spen UTSW 4 141,220,770 (GRCm39) missense unknown
R7018:Spen UTSW 4 141,220,755 (GRCm39) missense unknown
R7040:Spen UTSW 4 141,221,693 (GRCm39) missense unknown
R7127:Spen UTSW 4 141,203,419 (GRCm39) missense possibly damaging 0.53
R7218:Spen UTSW 4 141,199,961 (GRCm39) missense possibly damaging 0.54
R7234:Spen UTSW 4 141,206,446 (GRCm39) missense unknown
R7316:Spen UTSW 4 141,204,365 (GRCm39) missense unknown
R7350:Spen UTSW 4 141,206,696 (GRCm39) missense unknown
R7356:Spen UTSW 4 141,199,235 (GRCm39) nonsense probably null
R7400:Spen UTSW 4 141,201,052 (GRCm39) missense probably damaging 1.00
R7470:Spen UTSW 4 141,206,605 (GRCm39) missense unknown
R7698:Spen UTSW 4 141,200,156 (GRCm39) missense probably damaging 1.00
R7858:Spen UTSW 4 141,215,442 (GRCm39) splice site probably null
R8033:Spen UTSW 4 141,199,057 (GRCm39) missense probably benign 0.03
R8064:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R8159:Spen UTSW 4 141,202,314 (GRCm39) missense possibly damaging 0.53
R8187:Spen UTSW 4 141,200,216 (GRCm39) missense possibly damaging 0.93
R8463:Spen UTSW 4 141,249,590 (GRCm39) missense unknown
R8557:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8558:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8672:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8673:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8674:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8714:Spen UTSW 4 141,215,314 (GRCm39) missense unknown
R8762:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R8877:Spen UTSW 4 141,199,137 (GRCm39) nonsense probably null
R8878:Spen UTSW 4 141,204,520 (GRCm39) missense unknown
R8937:Spen UTSW 4 141,201,374 (GRCm39) missense probably damaging 1.00
R8939:Spen UTSW 4 141,202,969 (GRCm39) missense possibly damaging 0.72
R8968:Spen UTSW 4 141,197,701 (GRCm39) missense probably benign 0.02
R8971:Spen UTSW 4 141,201,889 (GRCm39) missense possibly damaging 0.53
R9016:Spen UTSW 4 141,200,938 (GRCm39) missense probably damaging 1.00
R9072:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9073:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9120:Spen UTSW 4 141,200,233 (GRCm39) missense
R9136:Spen UTSW 4 141,249,623 (GRCm39) missense unknown
R9138:Spen UTSW 4 141,196,797 (GRCm39) missense probably damaging 1.00
R9150:Spen UTSW 4 141,244,468 (GRCm39) missense unknown
R9225:Spen UTSW 4 141,202,943 (GRCm39) missense possibly damaging 0.53
R9492:Spen UTSW 4 141,199,098 (GRCm39) missense probably benign 0.26
R9537:Spen UTSW 4 141,244,156 (GRCm39) small deletion probably benign
R9537:Spen UTSW 4 141,199,015 (GRCm39) missense probably benign 0.15
R9602:Spen UTSW 4 141,205,183 (GRCm39) missense unknown
R9609:Spen UTSW 4 141,215,419 (GRCm39) missense unknown
R9686:Spen UTSW 4 141,199,946 (GRCm39) missense probably benign 0.27
R9697:Spen UTSW 4 141,196,275 (GRCm39) missense probably damaging 1.00
R9713:Spen UTSW 4 141,244,331 (GRCm39) missense unknown
T0722:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
T0975:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
Z1088:Spen UTSW 4 141,205,287 (GRCm39) missense unknown
Z1088:Spen UTSW 4 141,205,288 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAGGTGCCTGTGTCACAAC -3'
(R):5'- CAGAAGTACCCCATCGTGTG -3'

Sequencing Primer
(F):5'- ACACATGTGCACCTGCGAG -3'
(R):5'- CCATCGTGTGGCAGGGC -3'
Posted On 2021-03-08