Incidental Mutation 'R8735:Kndc1'
ID 662974
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 068583-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8735 (G1)
Quality Score 212.009
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139490130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 211 (S211G)
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
AlphaFold Q0KK55
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: S211G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S211G

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121839
AA Change: S211G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: S211G

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 155,845,731 (GRCm39) F9S unknown Het
Abhd10 A G 16: 45,557,997 (GRCm39) F101L probably damaging Het
Acp2 A G 2: 91,034,651 (GRCm39) T93A probably benign Het
Adamts9 C T 6: 92,837,048 (GRCm39) probably benign Het
Aknad1 T A 3: 108,682,615 (GRCm39) probably benign Het
Ank3 A T 10: 69,822,785 (GRCm39) T485S probably benign Het
Caly G A 7: 139,652,503 (GRCm39) R82C probably damaging Het
Cfhr2 A G 1: 139,786,343 (GRCm39) L8P probably damaging Het
Cpeb2 T A 5: 43,438,775 (GRCm39) L869* probably null Het
Cxxc1 A G 18: 74,350,331 (GRCm39) K33E possibly damaging Het
Cyp17a1 T C 19: 46,659,533 (GRCm39) probably null Het
Cyp4a30b G A 4: 115,309,976 (GRCm39) W59* probably null Het
Dennd4b T C 3: 90,185,172 (GRCm39) V1204A probably damaging Het
Dpyd T A 3: 118,935,565 (GRCm39) D663E possibly damaging Het
Esrrg A T 1: 187,933,205 (GRCm39) probably benign Het
Exoc2 A C 13: 31,090,822 (GRCm39) L261V probably damaging Het
Exosc9 T C 3: 36,609,662 (GRCm39) L185S probably damaging Het
Gcnt3 T C 9: 69,941,728 (GRCm39) K280R probably benign Het
Ighv1-64 A T 12: 115,471,217 (GRCm39) M100K probably benign Het
Impdh2 G A 9: 108,441,978 (GRCm39) probably null Het
Itsn2 T A 12: 4,721,474 (GRCm39) I1068K probably damaging Het
Kif5c T C 2: 49,584,783 (GRCm39) C169R probably damaging Het
Lama2 T A 10: 27,066,530 (GRCm39) E1117V probably damaging Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lsg1 T A 16: 30,399,865 (GRCm39) probably null Het
Mab21l4 C T 1: 93,082,208 (GRCm39) probably null Het
Msh3 A G 13: 92,411,374 (GRCm39) S608P possibly damaging Het
Mslnl T A 17: 25,964,062 (GRCm39) F464I probably benign Het
Mycbp2 T A 14: 103,460,586 (GRCm39) K1493N probably damaging Het
Myo15a A T 11: 60,401,679 (GRCm39) probably null Het
Myo1b A T 1: 51,794,896 (GRCm39) F1065I probably benign Het
Nf1 A G 11: 79,345,136 (GRCm39) probably benign Het
Nup153 C A 13: 46,881,027 (GRCm39) probably benign Het
Or4f4-ps1 T A 2: 111,330,497 (GRCm39) I300K probably damaging Het
Or5b97 A G 19: 12,878,274 (GRCm39) V290A possibly damaging Het
Osbpl7 A G 11: 96,943,194 (GRCm39) T149A probably benign Het
Parp1 A G 1: 180,396,690 (GRCm39) D31G probably benign Het
Pcdha6 T A 18: 37,101,203 (GRCm39) V132E possibly damaging Het
Pcdhb8 T A 18: 37,489,975 (GRCm39) L551Q possibly damaging Het
Pcsk9 T A 4: 106,311,808 (GRCm39) T190S probably damaging Het
Pdgfrb A T 18: 61,197,049 (GRCm39) T162S probably benign Het
Pi4ka C T 16: 17,136,234 (GRCm39) R908Q Het
Pnpla8 A G 12: 44,330,222 (GRCm39) E258G probably benign Het
Prrc2c A T 1: 162,537,127 (GRCm39) S643T unknown Het
Rnf20 T G 4: 49,655,964 (GRCm39) I970S possibly damaging Het
Robo2 A T 16: 73,755,247 (GRCm39) V758D probably damaging Het
Robo4 G A 9: 37,319,577 (GRCm39) S609N possibly damaging Het
Rrbp1 G A 2: 143,830,920 (GRCm39) Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Ryr2 C A 13: 11,701,833 (GRCm39) E2941D probably damaging Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Sh3rf1 G A 8: 61,825,687 (GRCm39) V561I probably benign Het
Slc4a4 T A 5: 89,280,301 (GRCm39) D366E probably damaging Het
Slfn14 T G 11: 83,174,715 (GRCm39) Q92P probably damaging Het
Slfn4 A T 11: 83,077,770 (GRCm39) Y186F probably damaging Het
Smpd4 T C 16: 17,453,410 (GRCm39) L309P possibly damaging Het
Smyd3 G T 1: 178,920,482 (GRCm39) N217K probably benign Het
Spen T C 4: 141,197,129 (GRCm39) T3547A probably benign Het
Suclg1 A T 6: 73,253,729 (GRCm39) I126F unknown Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmprss15 A T 16: 78,798,702 (GRCm39) I660N possibly damaging Het
Trf A T 9: 103,087,723 (GRCm39) V677D probably damaging Het
Trim36 T C 18: 46,302,452 (GRCm39) N532S probably benign Het
Trim37 T C 11: 87,037,885 (GRCm39) probably null Het
Ttn T C 2: 76,570,454 (GRCm39) N26813S probably benign Het
Vmn1r199 T A 13: 22,567,537 (GRCm39) V277D probably damaging Het
Wdfy3 T C 5: 102,077,951 (GRCm39) D873G probably benign Het
Wdr27 T C 17: 15,103,929 (GRCm39) T726A probably damaging Het
Wdr97 T C 15: 76,240,775 (GRCm39) Y488H Het
Wdtc1 A T 4: 133,031,511 (GRCm39) C236* probably null Het
Wnk4 A C 11: 101,167,092 (GRCm39) S1083R unknown Het
Wwc1 A T 11: 35,774,234 (GRCm39) I342N probably damaging Het
Zbtb40 A G 4: 136,725,957 (GRCm39) L534P probably damaging Het
Zfp62 T C 11: 49,108,227 (GRCm39) C773R probably damaging Het
Zfp709 T A 8: 72,643,027 (GRCm39) I152N probably benign Het
Zfp738 T C 13: 67,819,550 (GRCm39) Y147C probably damaging Het
Zscan18 A C 7: 12,503,625 (GRCm39) S645A probably benign Het
Zw10 A G 9: 48,988,861 (GRCm39) Y709C probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTATGTGACAATAGATCCTGGGG -3'
(R):5'- ACCATTTCTCACAGGGGCTG -3'

Sequencing Primer
(F):5'- AATAGATCCTGGGGGCCTCTG -3'
(R):5'- ATTTCTCACAGGGGCTGACAGC -3'
Posted On 2021-03-08