Incidental Mutation 'R8735:Robo4'
ID662978
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R8735 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37408281 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 609 (S609N)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102895
AA Change: S609N

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: S609N

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115046
AA Change: S661N

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: S661N

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: S498N

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect possibly damaging
Transcript: ENSMUST00000214185
AA Change: S609N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,154,486 probably null Het
6430550D23Rik A G 2: 156,003,811 F9S unknown Het
Abhd10 A G 16: 45,737,634 F101L probably damaging Het
Acp2 A G 2: 91,204,306 T93A probably benign Het
Ank3 A T 10: 69,986,955 T485S probably benign Het
Caly G A 7: 140,072,590 R82C probably damaging Het
Cfhr2 A G 1: 139,858,605 L8P probably damaging Het
Cpeb2 T A 5: 43,281,432 L869* probably null Het
Cxxc1 A G 18: 74,217,260 K33E possibly damaging Het
Cyp17a1 T C 19: 46,671,094 probably null Het
Cyp4a30b G A 4: 115,452,779 W59* probably null Het
Dennd4b T C 3: 90,277,865 V1204A probably damaging Het
Dpyd T A 3: 119,141,916 D663E possibly damaging Het
Exoc2 A C 13: 30,906,839 L261V probably damaging Het
Exosc9 T C 3: 36,555,513 L185S probably damaging Het
Gcnt3 T C 9: 70,034,446 K280R probably benign Het
Gm35339 T C 15: 76,356,575 Y488H Het
Ighv1-64 A T 12: 115,507,597 M100K probably benign Het
Impdh2 G A 9: 108,564,779 probably null Het
Itsn2 T A 12: 4,671,474 I1068K probably damaging Het
Kif5c T C 2: 49,694,771 C169R probably damaging Het
Kndc1 A G 7: 139,910,214 S211G probably benign Het
Lama2 T A 10: 27,190,534 E1117V probably damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lsg1 T A 16: 30,581,047 probably null Het
Msh3 A G 13: 92,274,866 S608P possibly damaging Het
Mslnl T A 17: 25,745,088 F464I probably benign Het
Mycbp2 T A 14: 103,223,150 K1493N probably damaging Het
Myo15 A T 11: 60,510,853 probably null Het
Myo1b A T 1: 51,755,737 F1065I probably benign Het
Nup153 C A 13: 46,727,551 probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr1447 A G 19: 12,900,910 V290A possibly damaging Het
Osbpl7 A G 11: 97,052,368 T149A probably benign Het
Parp1 A G 1: 180,569,125 D31G probably benign Het
Pcdha6 T A 18: 36,968,150 V132E possibly damaging Het
Pcdhb8 T A 18: 37,356,922 L551Q possibly damaging Het
Pcsk9 T A 4: 106,454,611 T190S probably damaging Het
Pdgfrb A T 18: 61,063,977 T162S probably benign Het
Pi4ka C T 16: 17,318,370 R908Q Het
Pnpla8 A G 12: 44,283,439 E258G probably benign Het
Prrc2c A T 1: 162,709,558 S643T unknown Het
Rnf20 T G 4: 49,655,964 I970S possibly damaging Het
Robo2 A T 16: 73,958,359 V758D probably damaging Het
Rrbp1 G A 2: 143,989,000 Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Ryr2 C A 13: 11,686,947 E2941D probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Sh3rf1 G A 8: 61,372,653 V561I probably benign Het
Slc4a4 T A 5: 89,132,442 D366E probably damaging Het
Slfn14 T G 11: 83,283,889 Q92P probably damaging Het
Slfn4 A T 11: 83,186,944 Y186F probably damaging Het
Smpd4 T C 16: 17,635,546 L309P possibly damaging Het
Smyd3 G T 1: 179,092,917 N217K probably benign Het
Spen T C 4: 141,469,818 T3547A probably benign Het
Suclg1 A T 6: 73,276,746 I126F unknown Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmprss15 A T 16: 79,001,814 I660N possibly damaging Het
Trf A T 9: 103,210,524 V677D probably damaging Het
Trim36 T C 18: 46,169,385 N532S probably benign Het
Trim37 T C 11: 87,147,059 probably null Het
Ttn T C 2: 76,740,110 N26813S probably benign Het
Vmn1r199 T A 13: 22,383,367 V277D probably damaging Het
Wdfy3 T C 5: 101,930,085 D873G probably benign Het
Wdr27 T C 17: 14,883,667 T726A probably damaging Het
Wdtc1 A T 4: 133,304,200 C236* probably null Het
Wnk4 A C 11: 101,276,266 S1083R unknown Het
Wwc1 A T 11: 35,883,407 I342N probably damaging Het
Zbtb40 A G 4: 136,998,646 L534P probably damaging Het
Zfp62 T C 11: 49,217,400 C773R probably damaging Het
Zfp709 T A 8: 71,889,183 I152N probably benign Het
Zfp738 T C 13: 67,671,431 Y147C probably damaging Het
Zscan18 A C 7: 12,769,698 S645A probably benign Het
Zw10 A G 9: 49,077,561 Y709C probably damaging Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R8079:Robo4 UTSW 9 37402635 missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37405640 missense probably damaging 0.99
R8280:Robo4 UTSW 9 37404076 missense probably benign 0.00
R8526:Robo4 UTSW 9 37403505 nonsense probably null
R8547:Robo4 UTSW 9 37404378 missense possibly damaging 0.69
R8836:Robo4 UTSW 9 37405834 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCGCTCCTGTAACTATGC -3'
(R):5'- CCCAGAGTGTGGCTTTTCTC -3'

Sequencing Primer
(F):5'- CCTCGGGGATGCAAAGG -3'
(R):5'- AGAGTGTGGCTTTTCTCCCATC -3'
Posted On2021-03-08