Mutagenetix > Incidental Mutation

Incidental Mutation 'R8735:Trim37'

662990

Institutional Source

Beutler Lab

Gene Symbol

Trim37

Ensembl Gene

ENSMUSG00000018548

Gene Name

tripartite motif-containing 37

Synonyms

MUL, 1110032A10Rik, 2810004E07Rik, TEF3

MMRRC Submission

Accession Numbers

Genbank: NM_197987

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87127077-87220683 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 87147059 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000049057 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041282] [ENSMUST00000041282] [ENSMUST00000139532]

AlphaFold

Q6PCX9

Predicted Effect

probably null
Transcript: ENSMUST00000041282

SMART Domains

Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548

Domain	Start	End	E-Value	Type
RING	15	54	1.71e-1	SMART
BBOX	90	132	7.32e-12	SMART
BBC	132	254	3.05e-31	SMART
MATH	281	384	1.51e-13	SMART
low complexity region	494	504	N/A	INTRINSIC
low complexity region	516	529	N/A	INTRINSIC
low complexity region	535	545	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	612	626	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000041282

SMART Domains

Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548

Domain	Start	End	E-Value	Type
RING	15	54	1.71e-1	SMART
BBOX	90	132	7.32e-12	SMART
BBC	132	254	3.05e-31	SMART
MATH	281	384	1.51e-13	SMART
low complexity region	494	504	N/A	INTRINSIC
low complexity region	516	529	N/A	INTRINSIC
low complexity region	535	545	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	612	626	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139532

SMART Domains

Protein: ENSMUSP00000119269
Gene: ENSMUSG00000018548

Domain	Start	End	E-Value	Type
BBOX	75	117	7.32e-12	SMART

Meta Mutation Damage Score

0.9502

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Gene trapped(7)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	C	T	1: 93,154,486		probably null	Het
6430550D23Rik	A	G	2: 156,003,811	F9S	unknown	Het
Abhd10	A	G	16: 45,737,634	F101L	probably damaging	Het
Acp2	A	G	2: 91,204,306	T93A	probably benign	Het
Adamts9	C	T	6: 92,860,067		probably benign	Het
Aknad1	T	A	3: 108,775,299		probably benign	Het
Ank3	A	T	10: 69,986,955	T485S	probably benign	Het
Caly	G	A	7: 140,072,590	R82C	probably damaging	Het
Cfhr2	A	G	1: 139,858,605	L8P	probably damaging	Het
Cpeb2	T	A	5: 43,281,432	L869*	probably null	Het
Cxxc1	A	G	18: 74,217,260	K33E	possibly damaging	Het
Cyp17a1	T	C	19: 46,671,094		probably null	Het
Cyp4a30b	G	A	4: 115,452,779	W59*	probably null	Het
Dennd4b	T	C	3: 90,277,865	V1204A	probably damaging	Het
Dpyd	T	A	3: 119,141,916	D663E	possibly damaging	Het
Esrrg	A	T	1: 188,201,008		probably benign	Het
Exoc2	A	C	13: 30,906,839	L261V	probably damaging	Het
Exosc9	T	C	3: 36,555,513	L185S	probably damaging	Het
Gcnt3	T	C	9: 70,034,446	K280R	probably benign	Het
Gm35339	T	C	15: 76,356,575	Y488H		Het
Ighv1-64	A	T	12: 115,507,597	M100K	probably benign	Het
Impdh2	G	A	9: 108,564,779		probably null	Het
Itsn2	T	A	12: 4,671,474	I1068K	probably damaging	Het
Kif5c	T	C	2: 49,694,771	C169R	probably damaging	Het
Kndc1	A	G	7: 139,910,214	S211G	probably benign	Het
Lama2	T	A	10: 27,190,534	E1117V	probably damaging	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lsg1	T	A	16: 30,581,047		probably null	Het
Msh3	A	G	13: 92,274,866	S608P	possibly damaging	Het
Mslnl	T	A	17: 25,745,088	F464I	probably benign	Het
Mycbp2	T	A	14: 103,223,150	K1493N	probably damaging	Het
Myo15	A	T	11: 60,510,853		probably null	Het
Myo1b	A	T	1: 51,755,737	F1065I	probably benign	Het
Nf1	A	G	11: 79,454,310		probably benign	Het
Nup153	C	A	13: 46,727,551		probably benign	Het
Olfr1291-ps1	T	A	2: 111,500,152	I300K	probably damaging	Het
Olfr1447	A	G	19: 12,900,910	V290A	possibly damaging	Het
Osbpl7	A	G	11: 97,052,368	T149A	probably benign	Het
Parp1	A	G	1: 180,569,125	D31G	probably benign	Het
Pcdha6	T	A	18: 36,968,150	V132E	possibly damaging	Het
Pcdhb8	T	A	18: 37,356,922	L551Q	possibly damaging	Het
Pcsk9	T	A	4: 106,454,611	T190S	probably damaging	Het
Pdgfrb	A	T	18: 61,063,977	T162S	probably benign	Het
Pi4ka	C	T	16: 17,318,370	R908Q		Het
Pnpla8	A	G	12: 44,283,439	E258G	probably benign	Het
Prrc2c	A	T	1: 162,709,558	S643T	unknown	Het
Rnf20	T	G	4: 49,655,964	I970S	possibly damaging	Het
Robo2	A	T	16: 73,958,359	V758D	probably damaging	Het
Robo4	G	A	9: 37,408,281	S609N	possibly damaging	Het
Rrbp1	G	A	2: 143,989,000	Q416*	probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Ryr2	C	A	13: 11,686,947	E2941D	probably damaging	Het
Scd2	G	T	19: 44,301,304	C246F	probably benign	Het
Sh3rf1	G	A	8: 61,372,653	V561I	probably benign	Het
Slc4a4	T	A	5: 89,132,442	D366E	probably damaging	Het
Slfn14	T	G	11: 83,283,889	Q92P	probably damaging	Het
Slfn4	A	T	11: 83,186,944	Y186F	probably damaging	Het
Smpd4	T	C	16: 17,635,546	L309P	possibly damaging	Het
Smyd3	G	T	1: 179,092,917	N217K	probably benign	Het
Spen	T	C	4: 141,469,818	T3547A	probably benign	Het
Suclg1	A	T	6: 73,276,746	I126F	unknown	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tmprss15	A	T	16: 79,001,814	I660N	possibly damaging	Het
Trf	A	T	9: 103,210,524	V677D	probably damaging	Het
Trim36	T	C	18: 46,169,385	N532S	probably benign	Het
Ttn	T	C	2: 76,740,110	N26813S	probably benign	Het
Vmn1r199	T	A	13: 22,383,367	V277D	probably damaging	Het
Wdfy3	T	C	5: 101,930,085	D873G	probably benign	Het
Wdr27	T	C	17: 14,883,667	T726A	probably damaging	Het
Wdtc1	A	T	4: 133,304,200	C236*	probably null	Het
Wnk4	A	C	11: 101,276,266	S1083R	unknown	Het
Wwc1	A	T	11: 35,883,407	I342N	probably damaging	Het
Zbtb40	A	G	4: 136,998,646	L534P	probably damaging	Het
Zfp62	T	C	11: 49,217,400	C773R	probably damaging	Het
Zfp709	T	A	8: 71,889,183	I152N	probably benign	Het
Zfp738	T	C	13: 67,671,431	Y147C	probably damaging	Het
Zscan18	A	C	7: 12,769,698	S645A	probably benign	Het
Zw10	A	G	9: 49,077,561	Y709C	probably damaging	Het

Other mutations in Trim37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Trim37	APN	11	87186393	missense	probably damaging	1.00
IGL01372:Trim37	APN	11	87184946	missense	probably benign	0.00
IGL01510:Trim37	APN	11	87177860	missense	probably damaging	1.00
IGL02055:Trim37	APN	11	87166649	missense	probably benign	0.44
IGL02106:Trim37	APN	11	87201404	nonsense	probably null
IGL02251:Trim37	APN	11	87167430	splice site	probably benign
IGL02498:Trim37	APN	11	87185050	missense	probably benign
IGL02836:Trim37	APN	11	87196959	missense	probably benign	0.01
IGL03089:Trim37	APN	11	87190137	missense	probably damaging	1.00
IGL03302:Trim37	APN	11	87147001	missense	possibly damaging	0.89
IGL03347:Trim37	APN	11	87201621	missense	possibly damaging	0.80
G5030:Trim37	UTSW	11	87143141	missense	probably damaging	0.96
R0396:Trim37	UTSW	11	87146968	missense	probably damaging	1.00
R0544:Trim37	UTSW	11	87145502	nonsense	probably null
R0946:Trim37	UTSW	11	87146955	missense	probably damaging	0.99
R1481:Trim37	UTSW	11	87129759	nonsense	probably null
R1799:Trim37	UTSW	11	87178019	missense	probably damaging	1.00
R1851:Trim37	UTSW	11	87218306	missense	probably damaging	1.00
R2107:Trim37	UTSW	11	87159825	missense	probably benign	0.04
R3878:Trim37	UTSW	11	87206002	missense	probably benign	0.10
R4049:Trim37	UTSW	11	87140603	critical splice donor site	probably null
R4224:Trim37	UTSW	11	87216463	missense	probably damaging	1.00
R4486:Trim37	UTSW	11	87196825	missense	probably benign	0.31
R5244:Trim37	UTSW	11	87218257	missense	probably benign	0.10
R5343:Trim37	UTSW	11	87137603	missense	probably damaging	0.98
R5417:Trim37	UTSW	11	87166679	missense	probably damaging	1.00
R5894:Trim37	UTSW	11	87201440	missense	probably damaging	0.99
R5911:Trim37	UTSW	11	87196837	nonsense	probably null
R5957:Trim37	UTSW	11	87145551	missense	probably damaging	1.00
R6159:Trim37	UTSW	11	87216548	critical splice donor site	probably null
R6479:Trim37	UTSW	11	87216487	nonsense	probably null
R6527:Trim37	UTSW	11	87190084	missense	probably damaging	1.00
R7021:Trim37	UTSW	11	87167509	missense	probably benign	0.01
R7734:Trim37	UTSW	11	87177995	missense	probably damaging	1.00
R7849:Trim37	UTSW	11	87201444	missense	possibly damaging	0.87
R7938:Trim37	UTSW	11	87147037	missense	probably benign	0.05
R7968:Trim37	UTSW	11	87149353	missense	possibly damaging	0.47
R8046:Trim37	UTSW	11	87146968	missense	possibly damaging	0.89
R8112:Trim37	UTSW	11	87218267	missense	possibly damaging	0.80
R8770:Trim37	UTSW	11	87159849	missense	probably damaging	1.00
R8911:Trim37	UTSW	11	87206803	missense	possibly damaging	0.89
R9234:Trim37	UTSW	11	87145567	missense	possibly damaging	0.95
R9332:Trim37	UTSW	11	87167502	missense	possibly damaging	0.94
R9346:Trim37	UTSW	11	87166600	critical splice acceptor site	probably null
R9431:Trim37	UTSW	11	87186431	missense	probably benign	0.34
Z1177:Trim37	UTSW	11	87185043	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTTCTGTTGTAAAGGACTTCAG -3'
(R):5'- CAGTAGTGGCATCTTCTCTTAGTTG -3'

Sequencing Primer
(F):5'- AGGACTTCAGTTACAATTTGTCCTTC -3'
(R):5'- AGGATTTTCATACAATGGCTGTG -3'

Posted On

2021-03-08