Mutagenetix > Incidental Mutation

Incidental Mutation 'R8735:Ryr2'

662996

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

068583-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11567988-12121831 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 11701833 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 2941 (E2941D)

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000021750
AA Change: E2941D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: E2941D

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170156
AA Change: E2941D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: E2941D

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430550D23Rik	A	G	2: 155,845,731 (GRCm39)	F9S	unknown	Het
Abhd10	A	G	16: 45,557,997 (GRCm39)	F101L	probably damaging	Het
Acp2	A	G	2: 91,034,651 (GRCm39)	T93A	probably benign	Het
Adamts9	C	T	6: 92,837,048 (GRCm39)		probably benign	Het
Aknad1	T	A	3: 108,682,615 (GRCm39)		probably benign	Het
Ank3	A	T	10: 69,822,785 (GRCm39)	T485S	probably benign	Het
Caly	G	A	7: 139,652,503 (GRCm39)	R82C	probably damaging	Het
Cfhr2	A	G	1: 139,786,343 (GRCm39)	L8P	probably damaging	Het
Cpeb2	T	A	5: 43,438,775 (GRCm39)	L869*	probably null	Het
Cxxc1	A	G	18: 74,350,331 (GRCm39)	K33E	possibly damaging	Het
Cyp17a1	T	C	19: 46,659,533 (GRCm39)		probably null	Het
Cyp4a30b	G	A	4: 115,309,976 (GRCm39)	W59*	probably null	Het
Dennd4b	T	C	3: 90,185,172 (GRCm39)	V1204A	probably damaging	Het
Dpyd	T	A	3: 118,935,565 (GRCm39)	D663E	possibly damaging	Het
Esrrg	A	T	1: 187,933,205 (GRCm39)		probably benign	Het
Exoc2	A	C	13: 31,090,822 (GRCm39)	L261V	probably damaging	Het
Exosc9	T	C	3: 36,609,662 (GRCm39)	L185S	probably damaging	Het
Gcnt3	T	C	9: 69,941,728 (GRCm39)	K280R	probably benign	Het
Ighv1-64	A	T	12: 115,471,217 (GRCm39)	M100K	probably benign	Het
Impdh2	G	A	9: 108,441,978 (GRCm39)		probably null	Het
Itsn2	T	A	12: 4,721,474 (GRCm39)	I1068K	probably damaging	Het
Kif5c	T	C	2: 49,584,783 (GRCm39)	C169R	probably damaging	Het
Kndc1	A	G	7: 139,490,130 (GRCm39)	S211G	probably benign	Het
Lama2	T	A	10: 27,066,530 (GRCm39)	E1117V	probably damaging	Het
Lgals4	C	T	7: 28,540,921 (GRCm39)	R282C	probably damaging	Het
Lsg1	T	A	16: 30,399,865 (GRCm39)		probably null	Het
Mab21l4	C	T	1: 93,082,208 (GRCm39)		probably null	Het
Msh3	A	G	13: 92,411,374 (GRCm39)	S608P	possibly damaging	Het
Mslnl	T	A	17: 25,964,062 (GRCm39)	F464I	probably benign	Het
Mycbp2	T	A	14: 103,460,586 (GRCm39)	K1493N	probably damaging	Het
Myo15a	A	T	11: 60,401,679 (GRCm39)		probably null	Het
Myo1b	A	T	1: 51,794,896 (GRCm39)	F1065I	probably benign	Het
Nf1	A	G	11: 79,345,136 (GRCm39)		probably benign	Het
Nup153	C	A	13: 46,881,027 (GRCm39)		probably benign	Het
Or4f4-ps1	T	A	2: 111,330,497 (GRCm39)	I300K	probably damaging	Het
Or5b97	A	G	19: 12,878,274 (GRCm39)	V290A	possibly damaging	Het
Osbpl7	A	G	11: 96,943,194 (GRCm39)	T149A	probably benign	Het
Parp1	A	G	1: 180,396,690 (GRCm39)	D31G	probably benign	Het
Pcdha6	T	A	18: 37,101,203 (GRCm39)	V132E	possibly damaging	Het
Pcdhb8	T	A	18: 37,489,975 (GRCm39)	L551Q	possibly damaging	Het
Pcsk9	T	A	4: 106,311,808 (GRCm39)	T190S	probably damaging	Het
Pdgfrb	A	T	18: 61,197,049 (GRCm39)	T162S	probably benign	Het
Pi4ka	C	T	16: 17,136,234 (GRCm39)	R908Q		Het
Pnpla8	A	G	12: 44,330,222 (GRCm39)	E258G	probably benign	Het
Prrc2c	A	T	1: 162,537,127 (GRCm39)	S643T	unknown	Het
Rnf20	T	G	4: 49,655,964 (GRCm39)	I970S	possibly damaging	Het
Robo2	A	T	16: 73,755,247 (GRCm39)	V758D	probably damaging	Het
Robo4	G	A	9: 37,319,577 (GRCm39)	S609N	possibly damaging	Het
Rrbp1	G	A	2: 143,830,920 (GRCm39)	Q416*	probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,229,114 (GRCm39)		probably benign	Het
Scd2	G	T	19: 44,289,743 (GRCm39)	C246F	probably benign	Het
Sh3rf1	G	A	8: 61,825,687 (GRCm39)	V561I	probably benign	Het
Slc4a4	T	A	5: 89,280,301 (GRCm39)	D366E	probably damaging	Het
Slfn14	T	G	11: 83,174,715 (GRCm39)	Q92P	probably damaging	Het
Slfn4	A	T	11: 83,077,770 (GRCm39)	Y186F	probably damaging	Het
Smpd4	T	C	16: 17,453,410 (GRCm39)	L309P	possibly damaging	Het
Smyd3	G	T	1: 178,920,482 (GRCm39)	N217K	probably benign	Het
Spen	T	C	4: 141,197,129 (GRCm39)	T3547A	probably benign	Het
Suclg1	A	T	6: 73,253,729 (GRCm39)	I126F	unknown	Het
Tenm4	C	T	7: 96,555,148 (GRCm39)	P2618S	probably benign	Het
Tmprss15	A	T	16: 78,798,702 (GRCm39)	I660N	possibly damaging	Het
Trf	A	T	9: 103,087,723 (GRCm39)	V677D	probably damaging	Het
Trim36	T	C	18: 46,302,452 (GRCm39)	N532S	probably benign	Het
Trim37	T	C	11: 87,037,885 (GRCm39)		probably null	Het
Ttn	T	C	2: 76,570,454 (GRCm39)	N26813S	probably benign	Het
Vmn1r199	T	A	13: 22,567,537 (GRCm39)	V277D	probably damaging	Het
Wdfy3	T	C	5: 102,077,951 (GRCm39)	D873G	probably benign	Het
Wdr27	T	C	17: 15,103,929 (GRCm39)	T726A	probably damaging	Het
Wdr97	T	C	15: 76,240,775 (GRCm39)	Y488H		Het
Wdtc1	A	T	4: 133,031,511 (GRCm39)	C236*	probably null	Het
Wnk4	A	C	11: 101,167,092 (GRCm39)	S1083R	unknown	Het
Wwc1	A	T	11: 35,774,234 (GRCm39)	I342N	probably damaging	Het
Zbtb40	A	G	4: 136,725,957 (GRCm39)	L534P	probably damaging	Het
Zfp62	T	C	11: 49,108,227 (GRCm39)	C773R	probably damaging	Het
Zfp709	T	A	8: 72,643,027 (GRCm39)	I152N	probably benign	Het
Zfp738	T	C	13: 67,819,550 (GRCm39)	Y147C	probably damaging	Het
Zscan18	A	C	7: 12,503,625 (GRCm39)	S645A	probably benign	Het
Zw10	A	G	9: 48,988,861 (GRCm39)	Y709C	probably damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,848,978 (GRCm39)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,633,490 (GRCm39)	splice site	probably null
IGL00838:Ryr2	APN	13	11,583,389 (GRCm39)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,600,364 (GRCm39)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,750,388 (GRCm39)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,718,430 (GRCm39)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,653,371 (GRCm39)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,602,125 (GRCm39)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,571,571 (GRCm39)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,606,238 (GRCm39)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,756,922 (GRCm39)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,814,723 (GRCm39)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,866,090 (GRCm39)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,736,676 (GRCm39)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,736,647 (GRCm39)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,616,644 (GRCm39)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,606,202 (GRCm39)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,609,854 (GRCm39)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,707,563 (GRCm39)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,600,366 (GRCm39)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,616,728 (GRCm39)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,610,311 (GRCm39)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,569,436 (GRCm39)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,611,998 (GRCm39)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,762,450 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,587,143 (GRCm39)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,807,648 (GRCm39)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,750,442 (GRCm39)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,774,645 (GRCm39)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,756,755 (GRCm39)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,745,274 (GRCm39)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,762,544 (GRCm39)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,634,382 (GRCm39)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,737,607 (GRCm39)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,620,130 (GRCm39)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,760,084 (GRCm39)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,760,560 (GRCm39)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,720,585 (GRCm39)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,569,397 (GRCm39)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,620,075 (GRCm39)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,753,206 (GRCm39)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,670,563 (GRCm39)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,610,076 (GRCm39)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,722,679 (GRCm39)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,933,205 (GRCm39)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,606,155 (GRCm39)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,774,721 (GRCm39)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,699,365 (GRCm39)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,658,788 (GRCm39)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,650,468 (GRCm39)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,868,036 (GRCm39)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,756,909 (GRCm39)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,583,449 (GRCm39)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,739,273 (GRCm39)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,787,302 (GRCm39)	missense	probably benign
IGL03410:Ryr2	APN	13	11,603,033 (GRCm39)	missense	probably damaging	0.99
Arruda	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,732,027 (GRCm39)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,680,848 (GRCm39)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,776,192 (GRCm39)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,722,682 (GRCm39)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,609,641 (GRCm39)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,839,265 (GRCm39)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,680,805 (GRCm39)	missense	probably benign
R0018:Ryr2	UTSW	13	11,610,109 (GRCm39)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,683,924 (GRCm39)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,583,361 (GRCm39)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,724,807 (GRCm39)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,729,434 (GRCm39)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,691,137 (GRCm39)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,787,442 (GRCm39)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,731,863 (GRCm39)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,683,725 (GRCm39)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,720,570 (GRCm39)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,848,981 (GRCm39)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,814,747 (GRCm39)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,653,329 (GRCm39)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,746,555 (GRCm39)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,650,445 (GRCm39)	missense	probably null
R0601:Ryr2	UTSW	13	11,720,519 (GRCm39)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,637,838 (GRCm39)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,739,219 (GRCm39)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,581,771 (GRCm39)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,753,012 (GRCm39)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,684,855 (GRCm39)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,960,867 (GRCm39)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,674,999 (GRCm39)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,897,929 (GRCm39)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,702,765 (GRCm39)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,609,962 (GRCm39)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,729,389 (GRCm39)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,753,035 (GRCm39)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,741,908 (GRCm39)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,616,727 (GRCm39)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,569,478 (GRCm39)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,569,435 (GRCm39)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,800,029 (GRCm39)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,774,563 (GRCm39)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,809,449 (GRCm39)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,733,368 (GRCm39)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,618,665 (GRCm39)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,746,543 (GRCm39)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,602,328 (GRCm39)	splice site	probably null
R1728:Ryr2	UTSW	13	11,602,308 (GRCm39)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,805,153 (GRCm39)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,715,257 (GRCm39)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,610,167 (GRCm39)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,575,472 (GRCm39)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,602,202 (GRCm39)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,784,764 (GRCm39)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,746,586 (GRCm39)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,676,961 (GRCm39)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,753,242 (GRCm39)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,673,844 (GRCm39)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,765,818 (GRCm39)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,606,222 (GRCm39)	missense	probably benign
R1909:Ryr2	UTSW	13	11,715,235 (GRCm39)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,571,584 (GRCm39)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,746,609 (GRCm39)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,695,966 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,600,288 (GRCm39)	splice site	probably null
R2018:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,610,622 (GRCm39)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,680,764 (GRCm39)	splice site	probably null
R2088:Ryr2	UTSW	13	11,677,115 (GRCm39)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,727,081 (GRCm39)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,575,493 (GRCm39)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,592,759 (GRCm39)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,720,679 (GRCm39)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,825,823 (GRCm39)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,677,146 (GRCm39)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,753,102 (GRCm39)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,753,128 (GRCm39)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,606,123 (GRCm39)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,816,734 (GRCm39)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,787,466 (GRCm39)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,603,045 (GRCm39)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,753,095 (GRCm39)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,787,313 (GRCm39)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,933,300 (GRCm39)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,707,568 (GRCm39)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,794,153 (GRCm39)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,602,323 (GRCm39)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,765,611 (GRCm39)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,664,698 (GRCm39)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,620,119 (GRCm39)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,731,952 (GRCm39)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,750,413 (GRCm39)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,121,301 (GRCm39)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,764,395 (GRCm39)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,765,571 (GRCm39)	splice site	probably null
R4668:Ryr2	UTSW	13	11,608,003 (GRCm39)	missense	probably benign
R4677:Ryr2	UTSW	13	11,721,553 (GRCm39)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,839,255 (GRCm39)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,610,119 (GRCm39)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,707,532 (GRCm39)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,731,884 (GRCm39)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,752,639 (GRCm39)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,671,933 (GRCm39)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,731,983 (GRCm39)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,670,584 (GRCm39)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,760,638 (GRCm39)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,683,706 (GRCm39)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,767,104 (GRCm39)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,724,849 (GRCm39)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,960,831 (GRCm39)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,756,897 (GRCm39)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,799,966 (GRCm39)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,610,192 (GRCm39)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,602,140 (GRCm39)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,650,422 (GRCm39)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,715,240 (GRCm39)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,727,129 (GRCm39)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,677,016 (GRCm39)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,675,175 (GRCm39)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,767,207 (GRCm39)	missense	probably benign
R5187:Ryr2	UTSW	13	11,787,338 (GRCm39)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,653,316 (GRCm39)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,787,323 (GRCm39)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,705,249 (GRCm39)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,571,544 (GRCm39)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,720,542 (GRCm39)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,720,587 (GRCm39)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,702,795 (GRCm39)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,723,088 (GRCm39)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,616,691 (GRCm39)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,610,468 (GRCm39)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,774,722 (GRCm39)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,784,848 (GRCm39)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,575,460 (GRCm39)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,599,040 (GRCm39)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,805,218 (GRCm39)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,702,788 (GRCm39)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,675,008 (GRCm39)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,741,839 (GRCm39)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,677,124 (GRCm39)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,729,397 (GRCm39)	splice site	probably null
R6104:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,807,575 (GRCm39)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,683,903 (GRCm39)	missense	probably benign
R6208:Ryr2	UTSW	13	11,910,106 (GRCm39)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,848,964 (GRCm39)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,674,993 (GRCm39)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,776,282 (GRCm39)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,677,269 (GRCm39)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,848,893 (GRCm39)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,683,707 (GRCm39)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,724,951 (GRCm39)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,610,529 (GRCm39)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,753,348 (GRCm39)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,701,852 (GRCm39)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,741,816 (GRCm39)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,844,540 (GRCm39)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,842,445 (GRCm39)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,581,834 (GRCm39)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,816,129 (GRCm39)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,669,266 (GRCm39)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,727,052 (GRCm39)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,809,491 (GRCm39)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,839,286 (GRCm39)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,664,662 (GRCm39)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,684,873 (GRCm39)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,683,697 (GRCm39)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,655,213 (GRCm39)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,825,794 (GRCm39)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,816,063 (GRCm39)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,701,864 (GRCm39)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,774,643 (GRCm39)	missense	probably benign
R7189:Ryr2	UTSW	13	11,898,009 (GRCm39)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,680,799 (GRCm39)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,612,032 (GRCm39)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,753,080 (GRCm39)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,760,517 (GRCm39)	missense	probably benign
R7365:Ryr2	UTSW	13	11,655,161 (GRCm39)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,799,997 (GRCm39)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,750,506 (GRCm39)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,571,634 (GRCm39)	splice site	probably null
R7425:Ryr2	UTSW	13	11,720,530 (GRCm39)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,570,349 (GRCm39)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,767,168 (GRCm39)	missense	probably benign
R7460:Ryr2	UTSW	13	11,720,596 (GRCm39)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,609,762 (GRCm39)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,653,317 (GRCm39)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,752,871 (GRCm39)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,575,539 (GRCm39)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,776,213 (GRCm39)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,776,201 (GRCm39)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,705,219 (GRCm39)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,745,229 (GRCm39)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,765,897 (GRCm39)	missense	probably benign
R7797:Ryr2	UTSW	13	11,816,066 (GRCm39)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,842,493 (GRCm39)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,721,509 (GRCm39)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,610,610 (GRCm39)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,807,634 (GRCm39)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,661,313 (GRCm39)	splice site	probably null
R8008:Ryr2	UTSW	13	11,671,980 (GRCm39)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,603,026 (GRCm39)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,960,881 (GRCm39)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,618,584 (GRCm39)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,842,439 (GRCm39)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,610,392 (GRCm39)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,814,718 (GRCm39)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,683,821 (GRCm39)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,699,364 (GRCm39)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,673,894 (GRCm39)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,592,664 (GRCm39)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,575,479 (GRCm39)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,702,875 (GRCm39)	missense	probably damaging	0.99
R8766:Ryr2	UTSW	13	11,683,855 (GRCm39)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,750,509 (GRCm39)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,572,934 (GRCm39)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,799,990 (GRCm39)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,814,768 (GRCm39)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,609,924 (GRCm39)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,609,672 (GRCm39)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,752,989 (GRCm39)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,610,817 (GRCm39)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,616,724 (GRCm39)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,618,741 (GRCm39)	intron	probably benign
R9116:Ryr2	UTSW	13	11,587,185 (GRCm39)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,669,292 (GRCm39)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,900,424 (GRCm39)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,610,772 (GRCm39)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,765,854 (GRCm39)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,721,578 (GRCm39)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,695,973 (GRCm39)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,809,459 (GRCm39)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,787,463 (GRCm39)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,752,680 (GRCm39)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,571,490 (GRCm39)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,602,101 (GRCm39)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,760,104 (GRCm39)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,737,646 (GRCm39)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,701,935 (GRCm39)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,609,785 (GRCm39)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,707,599 (GRCm39)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,718,387 (GRCm39)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,658,689 (GRCm39)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,613,497 (GRCm39)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,809,435 (GRCm39)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,765,759 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AAATCCAACCTCCTCTCTAGCTG -3'
(R):5'- GCCTTCCATCATTTAGGCAAAC -3'

Sequencing Primer
(F):5'- AACCTCCTCTCTAGCTGCTTGC -3'
(R):5'- TTAGCAACAGTAGTGGAACGATTCAC -3'

Posted On

2021-03-08