Mutagenetix > Incidental Mutation

Incidental Mutation 'R8735:Exoc2'

662998

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R8735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 30906839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 261 (L261V)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021785
AA Change: L261V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: L261V

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102946
AA Change: L261V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: L261V

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	C	T	1: 93,154,486		probably null	Het
6430550D23Rik	A	G	2: 156,003,811	F9S	unknown	Het
Abhd10	A	G	16: 45,737,634	F101L	probably damaging	Het
Acp2	A	G	2: 91,204,306	T93A	probably benign	Het
Adamts9	C	T	6: 92,860,067		probably benign	Het
Aknad1	T	A	3: 108,775,299		probably benign	Het
Ank3	A	T	10: 69,986,955	T485S	probably benign	Het
Caly	G	A	7: 140,072,590	R82C	probably damaging	Het
Cfhr2	A	G	1: 139,858,605	L8P	probably damaging	Het
Cpeb2	T	A	5: 43,281,432	L869*	probably null	Het
Cxxc1	A	G	18: 74,217,260	K33E	possibly damaging	Het
Cyp17a1	T	C	19: 46,671,094		probably null	Het
Cyp4a30b	G	A	4: 115,452,779	W59*	probably null	Het
Dennd4b	T	C	3: 90,277,865	V1204A	probably damaging	Het
Dpyd	T	A	3: 119,141,916	D663E	possibly damaging	Het
Esrrg	A	T	1: 188,201,008		probably benign	Het
Exosc9	T	C	3: 36,555,513	L185S	probably damaging	Het
Gcnt3	T	C	9: 70,034,446	K280R	probably benign	Het
Gm35339	T	C	15: 76,356,575	Y488H		Het
Ighv1-64	A	T	12: 115,507,597	M100K	probably benign	Het
Impdh2	G	A	9: 108,564,779		probably null	Het
Itsn2	T	A	12: 4,671,474	I1068K	probably damaging	Het
Kif5c	T	C	2: 49,694,771	C169R	probably damaging	Het
Kndc1	A	G	7: 139,910,214	S211G	probably benign	Het
Lama2	T	A	10: 27,190,534	E1117V	probably damaging	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lsg1	T	A	16: 30,581,047		probably null	Het
Msh3	A	G	13: 92,274,866	S608P	possibly damaging	Het
Mslnl	T	A	17: 25,745,088	F464I	probably benign	Het
Mycbp2	T	A	14: 103,223,150	K1493N	probably damaging	Het
Myo15	A	T	11: 60,510,853		probably null	Het
Myo1b	A	T	1: 51,755,737	F1065I	probably benign	Het
Nf1	A	G	11: 79,454,310		probably benign	Het
Nup153	C	A	13: 46,727,551		probably benign	Het
Olfr1291-ps1	T	A	2: 111,500,152	I300K	probably damaging	Het
Olfr1447	A	G	19: 12,900,910	V290A	possibly damaging	Het
Osbpl7	A	G	11: 97,052,368	T149A	probably benign	Het
Parp1	A	G	1: 180,569,125	D31G	probably benign	Het
Pcdha6	T	A	18: 36,968,150	V132E	possibly damaging	Het
Pcdhb8	T	A	18: 37,356,922	L551Q	possibly damaging	Het
Pcsk9	T	A	4: 106,454,611	T190S	probably damaging	Het
Pdgfrb	A	T	18: 61,063,977	T162S	probably benign	Het
Pi4ka	C	T	16: 17,318,370	R908Q		Het
Pnpla8	A	G	12: 44,283,439	E258G	probably benign	Het
Prrc2c	A	T	1: 162,709,558	S643T	unknown	Het
Rnf20	T	G	4: 49,655,964	I970S	possibly damaging	Het
Robo2	A	T	16: 73,958,359	V758D	probably damaging	Het
Robo4	G	A	9: 37,408,281	S609N	possibly damaging	Het
Rrbp1	G	A	2: 143,989,000	Q416*	probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Ryr2	C	A	13: 11,686,947	E2941D	probably damaging	Het
Scd2	G	T	19: 44,301,304	C246F	probably benign	Het
Sh3rf1	G	A	8: 61,372,653	V561I	probably benign	Het
Slc4a4	T	A	5: 89,132,442	D366E	probably damaging	Het
Slfn14	T	G	11: 83,283,889	Q92P	probably damaging	Het
Slfn4	A	T	11: 83,186,944	Y186F	probably damaging	Het
Smpd4	T	C	16: 17,635,546	L309P	possibly damaging	Het
Smyd3	G	T	1: 179,092,917	N217K	probably benign	Het
Spen	T	C	4: 141,469,818	T3547A	probably benign	Het
Suclg1	A	T	6: 73,276,746	I126F	unknown	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tmprss15	A	T	16: 79,001,814	I660N	possibly damaging	Het
Trf	A	T	9: 103,210,524	V677D	probably damaging	Het
Trim36	T	C	18: 46,169,385	N532S	probably benign	Het
Trim37	T	C	11: 87,147,059		probably null	Het
Ttn	T	C	2: 76,740,110	N26813S	probably benign	Het
Vmn1r199	T	A	13: 22,383,367	V277D	probably damaging	Het
Wdfy3	T	C	5: 101,930,085	D873G	probably benign	Het
Wdr27	T	C	17: 14,883,667	T726A	probably damaging	Het
Wdtc1	A	T	4: 133,304,200	C236*	probably null	Het
Wnk4	A	C	11: 101,276,266	S1083R	unknown	Het
Wwc1	A	T	11: 35,883,407	I342N	probably damaging	Het
Zbtb40	A	G	4: 136,998,646	L534P	probably damaging	Het
Zfp62	T	C	11: 49,217,400	C773R	probably damaging	Het
Zfp709	T	A	8: 71,889,183	I152N	probably benign	Het
Zfp738	T	C	13: 67,671,431	Y147C	probably damaging	Het
Zscan18	A	C	7: 12,769,698	S645A	probably benign	Het
Zw10	A	G	9: 49,077,561	Y709C	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACACGTTGTGAGATCATTAGGAAAG -3'
(R):5'- TGAAGACAGTTTCCCATATCCC -3'

Sequencing Primer
(F):5'- TCATTAGGAAAGAACAATGAGCAC -3'
(R):5'- CCCATTTATTAACTGTAGTGTGATGC -3'

Posted On

2021-03-08