Incidental Mutation 'R8735:Mslnl'
ID 663011
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 068583-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8735 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25964062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 464 (F464I)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
AlphaFold Q8C160
Predicted Effect probably benign
Transcript: ENSMUST00000047098
AA Change: F464I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: F464I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 155,845,731 (GRCm39) F9S unknown Het
Abhd10 A G 16: 45,557,997 (GRCm39) F101L probably damaging Het
Acp2 A G 2: 91,034,651 (GRCm39) T93A probably benign Het
Adamts9 C T 6: 92,837,048 (GRCm39) probably benign Het
Aknad1 T A 3: 108,682,615 (GRCm39) probably benign Het
Ank3 A T 10: 69,822,785 (GRCm39) T485S probably benign Het
Caly G A 7: 139,652,503 (GRCm39) R82C probably damaging Het
Cfhr2 A G 1: 139,786,343 (GRCm39) L8P probably damaging Het
Cpeb2 T A 5: 43,438,775 (GRCm39) L869* probably null Het
Cxxc1 A G 18: 74,350,331 (GRCm39) K33E possibly damaging Het
Cyp17a1 T C 19: 46,659,533 (GRCm39) probably null Het
Cyp4a30b G A 4: 115,309,976 (GRCm39) W59* probably null Het
Dennd4b T C 3: 90,185,172 (GRCm39) V1204A probably damaging Het
Dpyd T A 3: 118,935,565 (GRCm39) D663E possibly damaging Het
Esrrg A T 1: 187,933,205 (GRCm39) probably benign Het
Exoc2 A C 13: 31,090,822 (GRCm39) L261V probably damaging Het
Exosc9 T C 3: 36,609,662 (GRCm39) L185S probably damaging Het
Gcnt3 T C 9: 69,941,728 (GRCm39) K280R probably benign Het
Ighv1-64 A T 12: 115,471,217 (GRCm39) M100K probably benign Het
Impdh2 G A 9: 108,441,978 (GRCm39) probably null Het
Itsn2 T A 12: 4,721,474 (GRCm39) I1068K probably damaging Het
Kif5c T C 2: 49,584,783 (GRCm39) C169R probably damaging Het
Kndc1 A G 7: 139,490,130 (GRCm39) S211G probably benign Het
Lama2 T A 10: 27,066,530 (GRCm39) E1117V probably damaging Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lsg1 T A 16: 30,399,865 (GRCm39) probably null Het
Mab21l4 C T 1: 93,082,208 (GRCm39) probably null Het
Msh3 A G 13: 92,411,374 (GRCm39) S608P possibly damaging Het
Mycbp2 T A 14: 103,460,586 (GRCm39) K1493N probably damaging Het
Myo15a A T 11: 60,401,679 (GRCm39) probably null Het
Myo1b A T 1: 51,794,896 (GRCm39) F1065I probably benign Het
Nf1 A G 11: 79,345,136 (GRCm39) probably benign Het
Nup153 C A 13: 46,881,027 (GRCm39) probably benign Het
Or4f4-ps1 T A 2: 111,330,497 (GRCm39) I300K probably damaging Het
Or5b97 A G 19: 12,878,274 (GRCm39) V290A possibly damaging Het
Osbpl7 A G 11: 96,943,194 (GRCm39) T149A probably benign Het
Parp1 A G 1: 180,396,690 (GRCm39) D31G probably benign Het
Pcdha6 T A 18: 37,101,203 (GRCm39) V132E possibly damaging Het
Pcdhb8 T A 18: 37,489,975 (GRCm39) L551Q possibly damaging Het
Pcsk9 T A 4: 106,311,808 (GRCm39) T190S probably damaging Het
Pdgfrb A T 18: 61,197,049 (GRCm39) T162S probably benign Het
Pi4ka C T 16: 17,136,234 (GRCm39) R908Q Het
Pnpla8 A G 12: 44,330,222 (GRCm39) E258G probably benign Het
Prrc2c A T 1: 162,537,127 (GRCm39) S643T unknown Het
Rnf20 T G 4: 49,655,964 (GRCm39) I970S possibly damaging Het
Robo2 A T 16: 73,755,247 (GRCm39) V758D probably damaging Het
Robo4 G A 9: 37,319,577 (GRCm39) S609N possibly damaging Het
Rrbp1 G A 2: 143,830,920 (GRCm39) Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Ryr2 C A 13: 11,701,833 (GRCm39) E2941D probably damaging Het
Scd2 G T 19: 44,289,743 (GRCm39) C246F probably benign Het
Sh3rf1 G A 8: 61,825,687 (GRCm39) V561I probably benign Het
Slc4a4 T A 5: 89,280,301 (GRCm39) D366E probably damaging Het
Slfn14 T G 11: 83,174,715 (GRCm39) Q92P probably damaging Het
Slfn4 A T 11: 83,077,770 (GRCm39) Y186F probably damaging Het
Smpd4 T C 16: 17,453,410 (GRCm39) L309P possibly damaging Het
Smyd3 G T 1: 178,920,482 (GRCm39) N217K probably benign Het
Spen T C 4: 141,197,129 (GRCm39) T3547A probably benign Het
Suclg1 A T 6: 73,253,729 (GRCm39) I126F unknown Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmprss15 A T 16: 78,798,702 (GRCm39) I660N possibly damaging Het
Trf A T 9: 103,087,723 (GRCm39) V677D probably damaging Het
Trim36 T C 18: 46,302,452 (GRCm39) N532S probably benign Het
Trim37 T C 11: 87,037,885 (GRCm39) probably null Het
Ttn T C 2: 76,570,454 (GRCm39) N26813S probably benign Het
Vmn1r199 T A 13: 22,567,537 (GRCm39) V277D probably damaging Het
Wdfy3 T C 5: 102,077,951 (GRCm39) D873G probably benign Het
Wdr27 T C 17: 15,103,929 (GRCm39) T726A probably damaging Het
Wdr97 T C 15: 76,240,775 (GRCm39) Y488H Het
Wdtc1 A T 4: 133,031,511 (GRCm39) C236* probably null Het
Wnk4 A C 11: 101,167,092 (GRCm39) S1083R unknown Het
Wwc1 A T 11: 35,774,234 (GRCm39) I342N probably damaging Het
Zbtb40 A G 4: 136,725,957 (GRCm39) L534P probably damaging Het
Zfp62 T C 11: 49,108,227 (GRCm39) C773R probably damaging Het
Zfp709 T A 8: 72,643,027 (GRCm39) I152N probably benign Het
Zfp738 T C 13: 67,819,550 (GRCm39) Y147C probably damaging Het
Zscan18 A C 7: 12,503,625 (GRCm39) S645A probably benign Het
Zw10 A G 9: 48,988,861 (GRCm39) Y709C probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTGGTCTGCTTTGCCCAG -3'
(R):5'- AAAGGCCTAGAGAATTTAGTCACTCAG -3'

Sequencing Primer
(F):5'- TTTGCCCAGCCCCACTG -3'
(R):5'- TGTTGCAAGCACTCTACAGG -3'
Posted On 2021-03-08