Incidental Mutation 'R8736:Olfr835'
ID 663036
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor 835
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R8736 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19032735-19037670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19035478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 118 (M118I)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: M118I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: M118I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: M118I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,049 S2047T probably benign Het
Ccdc125 T C 13: 100,679,325 S100P possibly damaging Het
Ccnl1 T C 3: 65,958,026 T35A unknown Het
Cul2 T A 18: 3,434,019 V672E probably damaging Het
Cyb5a C A 18: 84,851,435 probably benign Het
Ddhd1 T A 14: 45,599,185 Y831F probably benign Het
Ddr1 A G 17: 35,684,212 I698T probably damaging Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Fcgbp G T 7: 28,106,196 V1967L probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gtf2h3 A G 5: 124,590,909 N177S probably damaging Het
Krt6b A G 15: 101,678,612 Y242H probably damaging Het
Mab21l2 C A 3: 86,547,300 R131L probably damaging Het
Maml1 T C 11: 50,257,899 T1005A possibly damaging Het
Mapk4 T C 18: 73,970,325 T38A probably benign Het
Mapkapk5 G A 5: 121,527,178 A338V possibly damaging Het
Morc2a C A 11: 3,681,737 T556K probably damaging Het
Muc16 G A 9: 18,550,843 Q7459* probably null Het
Muc6 T C 7: 141,642,172 T1256A possibly damaging Het
Olfr1271 A G 2: 90,265,578 V284A possibly damaging Het
Olfr1499 T C 19: 13,814,994 I199V probably benign Het
Olfr380 T A 11: 73,453,558 Y218F probably damaging Het
Olfr466 T G 13: 65,152,724 C167G probably damaging Het
Olfr76 A G 19: 12,119,945 C256R probably damaging Het
Pik3c2a A G 7: 116,376,229 V701A possibly damaging Het
Plxnb2 A T 15: 89,162,058 I918N probably damaging Het
Pms1 T C 1: 53,267,894 S118G possibly damaging Het
Ppp1r18 A G 17: 35,873,819 T549A probably benign Het
Rap1gds1 T C 3: 138,941,751 I559V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tlx1 A G 19: 45,153,536 T200A possibly damaging Het
Usp1 A G 4: 98,932,868 I488V probably damaging Het
Vmn2r6 T A 3: 64,559,800 M93L probably damaging Het
Zfp870 A T 17: 32,885,992 V31E possibly damaging Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
R8868:Olfr835 UTSW 9 19035482 missense probably damaging 1.00
R8909:Olfr835 UTSW 9 19035592 missense probably benign 0.08
R9116:Olfr835 UTSW 9 19035477 missense probably damaging 1.00
R9479:Olfr835 UTSW 9 19035434 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCATTTGCAAACACCCATGTAC -3'
(R):5'- GCTTCATGACCTGAGAAAGTTCAC -3'

Sequencing Primer
(F):5'- CAGGATCAGAGCATCAGT -3'
(R):5'- TCATGACCTGAGAAAGTTCACAGAAG -3'
Posted On 2021-03-08