Incidental Mutation 'R8736:Or7g20'
ID 663036
Institutional Source Beutler Lab
Gene Symbol Or7g20
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor family 7 subfamily G member 20
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930, Olfr835
MMRRC Submission 068617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R8736 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18946421-18947356 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 18946774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 118 (M118I)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: M118I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: M118I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: M118I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bltp2 T A 11: 78,178,875 (GRCm39) S2047T probably benign Het
Ccdc125 T C 13: 100,815,833 (GRCm39) S100P possibly damaging Het
Ccnl1 T C 3: 65,865,447 (GRCm39) T35A unknown Het
Cul2 T A 18: 3,434,019 (GRCm39) V672E probably damaging Het
Cyb5a C A 18: 84,869,560 (GRCm39) probably benign Het
Ddhd1 T A 14: 45,836,642 (GRCm39) Y831F probably benign Het
Ddr1 A G 17: 35,995,104 (GRCm39) I698T probably damaging Het
Elovl7 A T 13: 108,393,320 (GRCm39) I18F probably benign Het
Fcgbp G T 7: 27,805,621 (GRCm39) V1967L probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gtf2h3 A G 5: 124,728,972 (GRCm39) N177S probably damaging Het
Krt6b A G 15: 101,587,047 (GRCm39) Y242H probably damaging Het
Mab21l2 C A 3: 86,454,607 (GRCm39) R131L probably damaging Het
Maml1 T C 11: 50,148,726 (GRCm39) T1005A possibly damaging Het
Mapk4 T C 18: 74,103,396 (GRCm39) T38A probably benign Het
Mapkapk5 G A 5: 121,665,241 (GRCm39) A338V possibly damaging Het
Morc2a C A 11: 3,631,737 (GRCm39) T556K probably damaging Het
Muc16 G A 9: 18,462,139 (GRCm39) Q7459* probably null Het
Muc6 T C 7: 141,228,439 (GRCm39) T1256A possibly damaging Het
Or1e21 T A 11: 73,344,384 (GRCm39) Y218F probably damaging Het
Or4b12 A G 2: 90,095,922 (GRCm39) V284A possibly damaging Het
Or5a1 A G 19: 12,097,309 (GRCm39) C256R probably damaging Het
Or9i14 T C 19: 13,792,358 (GRCm39) I199V probably benign Het
Or9s18 T G 13: 65,300,538 (GRCm39) C167G probably damaging Het
Pik3c2a A G 7: 115,975,464 (GRCm39) V701A possibly damaging Het
Plxnb2 A T 15: 89,046,261 (GRCm39) I918N probably damaging Het
Pms1 T C 1: 53,307,053 (GRCm39) S118G possibly damaging Het
Ppp1r18 A G 17: 36,184,711 (GRCm39) T549A probably benign Het
Rap1gds1 T C 3: 138,647,512 (GRCm39) I559V probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tlx1 A G 19: 45,141,975 (GRCm39) T200A possibly damaging Het
Usp1 A G 4: 98,821,105 (GRCm39) I488V probably damaging Het
Vmn2r6 T A 3: 64,467,221 (GRCm39) M93L probably damaging Het
Zfp870 A T 17: 33,104,966 (GRCm39) V31E possibly damaging Het
Other mutations in Or7g20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Or7g20 APN 9 18,946,584 (GRCm39) nonsense probably null
IGL02546:Or7g20 APN 9 18,946,650 (GRCm39) missense possibly damaging 0.88
R0010:Or7g20 UTSW 9 18,946,618 (GRCm39) missense probably damaging 1.00
R0107:Or7g20 UTSW 9 18,946,629 (GRCm39) missense probably damaging 1.00
R1867:Or7g20 UTSW 9 18,946,562 (GRCm39) missense probably benign 0.36
R1891:Or7g20 UTSW 9 18,947,274 (GRCm39) missense probably damaging 0.99
R1941:Or7g20 UTSW 9 18,947,162 (GRCm39) missense possibly damaging 0.93
R4152:Or7g20 UTSW 9 18,946,816 (GRCm39) nonsense probably null
R5451:Or7g20 UTSW 9 18,946,787 (GRCm39) missense probably damaging 1.00
R5677:Or7g20 UTSW 9 18,946,854 (GRCm39) missense possibly damaging 0.93
R5970:Or7g20 UTSW 9 18,946,443 (GRCm39) missense probably benign
R6187:Or7g20 UTSW 9 18,946,689 (GRCm39) missense probably benign 0.12
R6805:Or7g20 UTSW 9 18,946,597 (GRCm39) missense probably damaging 1.00
R7183:Or7g20 UTSW 9 18,946,628 (GRCm39) missense probably damaging 1.00
R8029:Or7g20 UTSW 9 18,947,090 (GRCm39) missense probably damaging 1.00
R8139:Or7g20 UTSW 9 18,946,871 (GRCm39) missense probably benign 0.07
R8868:Or7g20 UTSW 9 18,946,778 (GRCm39) missense probably damaging 1.00
R8909:Or7g20 UTSW 9 18,946,888 (GRCm39) missense probably benign 0.08
R9116:Or7g20 UTSW 9 18,946,773 (GRCm39) missense probably damaging 1.00
R9479:Or7g20 UTSW 9 18,946,730 (GRCm39) missense probably benign 0.30
R9786:Or7g20 UTSW 9 18,947,241 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCATTTGCAAACACCCATGTAC -3'
(R):5'- GCTTCATGACCTGAGAAAGTTCAC -3'

Sequencing Primer
(F):5'- CAGGATCAGAGCATCAGT -3'
(R):5'- TCATGACCTGAGAAAGTTCACAGAAG -3'
Posted On 2021-03-08