Incidental Mutation 'R8736:Olfr466'
ID663041
Institutional Source Beutler Lab
Gene Symbol Olfr466
Ensembl Gene ENSMUSG00000049806
Gene Nameolfactory receptor 466
SynonymsGA_x6K02T2PB7A-3051266-3052192, MOR209-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8736 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location65150240-65156152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65152724 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 167 (C167G)
Ref Sequence ENSEMBL: ENSMUSP00000149328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]
Predicted Effect probably damaging
Transcript: ENSMUST00000058907
AA Change: C167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: C167G

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.8e-47 PFAM
Pfam:7tm_1 39 288 3.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214214
AA Change: C167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,049 S2047T probably benign Het
Ccdc125 T C 13: 100,679,325 S100P possibly damaging Het
Ccnl1 T C 3: 65,958,026 T35A unknown Het
Cul2 T A 18: 3,434,019 V672E probably damaging Het
Cyb5a C A 18: 84,851,435 probably benign Het
Ddhd1 T A 14: 45,599,185 Y831F probably benign Het
Ddr1 A G 17: 35,684,212 I698T probably damaging Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Fcgbp G T 7: 28,106,196 V1967L probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gtf2h3 A G 5: 124,590,909 N177S probably damaging Het
Krt6b A G 15: 101,678,612 Y242H probably damaging Het
Lce1f TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT 3: 92,718,965 probably benign Het
Mab21l2 C A 3: 86,547,300 R131L probably damaging Het
Maml1 T C 11: 50,257,899 T1005A possibly damaging Het
Mapk4 T C 18: 73,970,325 T38A probably benign Het
Mapkapk5 G A 5: 121,527,178 A338V possibly damaging Het
Morc2a C A 11: 3,681,737 T556K probably damaging Het
Muc16 G A 9: 18,550,843 Q7459* probably null Het
Muc6 T C 7: 141,642,172 T1256A possibly damaging Het
Olfr1271 A G 2: 90,265,578 V284A possibly damaging Het
Olfr1499 T C 19: 13,814,994 I199V probably benign Het
Olfr380 T A 11: 73,453,558 Y218F probably damaging Het
Olfr76 A G 19: 12,119,945 C256R probably damaging Het
Olfr835 G T 9: 19,035,478 M118I probably damaging Het
Pik3c2a A G 7: 116,376,229 V701A possibly damaging Het
Plxnb2 A T 15: 89,162,058 I918N probably damaging Het
Pms1 T C 1: 53,267,894 S118G possibly damaging Het
Ppp1r18 A G 17: 35,873,819 T549A probably benign Het
Rap1gds1 T C 3: 138,941,751 I559V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tlx1 A G 19: 45,153,536 T200A possibly damaging Het
Usp1 A G 4: 98,932,868 I488V probably damaging Het
Vmn2r6 T A 3: 64,559,800 M93L probably damaging Het
Zfp870 A T 17: 32,885,992 V31E possibly damaging Het
Other mutations in Olfr466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Olfr466 APN 13 65152396 missense probably damaging 0.99
R0269:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0617:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0646:Olfr466 UTSW 13 65153063 missense probably damaging 1.00
R1338:Olfr466 UTSW 13 65152383 missense probably damaging 1.00
R1893:Olfr466 UTSW 13 65152992 missense possibly damaging 0.92
R3108:Olfr466 UTSW 13 65153061 missense possibly damaging 0.89
R4408:Olfr466 UTSW 13 65152700 missense probably benign 0.00
R4625:Olfr466 UTSW 13 65152860 missense possibly damaging 0.95
R4732:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4733:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4849:Olfr466 UTSW 13 65152679 missense possibly damaging 0.96
R5058:Olfr466 UTSW 13 65152929 missense possibly damaging 0.96
R5419:Olfr466 UTSW 13 65152774 missense probably damaging 1.00
R5569:Olfr466 UTSW 13 65152979 missense possibly damaging 0.81
R5662:Olfr466 UTSW 13 65152253 missense possibly damaging 0.76
R7292:Olfr466 UTSW 13 65152842 missense possibly damaging 0.94
R7345:Olfr466 UTSW 13 65152743 missense possibly damaging 0.59
R7427:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R7428:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R8162:Olfr466 UTSW 13 65152920 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCACAGAAGCATTTCTCCTGG -3'
(R):5'- CACACGTGGAGAAAGCTTTC -3'

Sequencing Primer
(F):5'- GCTGCCATGGCCTATGAC -3'
(R):5'- CACTGTGCGGATCTTCAATATTG -3'
Posted On2021-03-08