Incidental Mutation 'R8736:Plxnb2'
ID663045
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R8736 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89162058 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 918 (I918N)
Ref Sequence ENSEMBL: ENSMUSP00000051731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: I918N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: I918N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: I918N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: I918N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,049 S2047T probably benign Het
Ccdc125 T C 13: 100,679,325 S100P possibly damaging Het
Ccnl1 T C 3: 65,958,026 T35A unknown Het
Cul2 T A 18: 3,434,019 V672E probably damaging Het
Cyb5a C A 18: 84,851,435 probably benign Het
Ddhd1 T A 14: 45,599,185 Y831F probably benign Het
Ddr1 A G 17: 35,684,212 I698T probably damaging Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Fcgbp G T 7: 28,106,196 V1967L probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gtf2h3 A G 5: 124,590,909 N177S probably damaging Het
Krt6b A G 15: 101,678,612 Y242H probably damaging Het
Lce1f TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT TCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCT 3: 92,718,965 probably benign Het
Mab21l2 C A 3: 86,547,300 R131L probably damaging Het
Maml1 T C 11: 50,257,899 T1005A possibly damaging Het
Mapk4 T C 18: 73,970,325 T38A probably benign Het
Mapkapk5 G A 5: 121,527,178 A338V possibly damaging Het
Morc2a C A 11: 3,681,737 T556K probably damaging Het
Muc16 G A 9: 18,550,843 Q7459* probably null Het
Muc6 T C 7: 141,642,172 T1256A possibly damaging Het
Olfr1271 A G 2: 90,265,578 V284A possibly damaging Het
Olfr1499 T C 19: 13,814,994 I199V probably benign Het
Olfr380 T A 11: 73,453,558 Y218F probably damaging Het
Olfr466 T G 13: 65,152,724 C167G probably damaging Het
Olfr76 A G 19: 12,119,945 C256R probably damaging Het
Olfr835 G T 9: 19,035,478 M118I probably damaging Het
Pik3c2a A G 7: 116,376,229 V701A possibly damaging Het
Pms1 T C 1: 53,267,894 S118G possibly damaging Het
Ppp1r18 A G 17: 35,873,819 T549A probably benign Het
Rap1gds1 T C 3: 138,941,751 I559V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tlx1 A G 19: 45,153,536 T200A possibly damaging Het
Usp1 A G 4: 98,932,868 I488V probably damaging Het
Vmn2r6 T A 3: 64,559,800 M93L probably damaging Het
Zfp870 A T 17: 32,885,992 V31E possibly damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACTTTGTCCTAGGGTGGG -3'
(R):5'- ACTGAGCTGTGTTGTCCAGC -3'

Sequencing Primer
(F):5'- GAGGTACCTGTCAGTCCATCAAG -3'
(R):5'- AGCTGTGTTGTCCAGCCTCTG -3'
Posted On2021-03-08