Incidental Mutation 'R8736:Krt6b'
ID 663046
Institutional Source Beutler Lab
Gene Symbol Krt6b
Ensembl Gene ENSMUSG00000023041
Gene Name keratin 6B
Synonyms Krt2-6b, mK6[b]
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R8736 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101676023-101680287 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101678612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 242 (Y242H)
Ref Sequence ENSEMBL: ENSMUSP00000023786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023786]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023786
AA Change: Y242H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023786
Gene: ENSMUSG00000023041
AA Change: Y242H

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 1.3e-36 PFAM
Filament 151 464 2.79e-175 SMART
low complexity region 483 537 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,049 S2047T probably benign Het
Ccdc125 T C 13: 100,679,325 S100P possibly damaging Het
Ccnl1 T C 3: 65,958,026 T35A unknown Het
Cul2 T A 18: 3,434,019 V672E probably damaging Het
Cyb5a C A 18: 84,851,435 probably benign Het
Ddhd1 T A 14: 45,599,185 Y831F probably benign Het
Ddr1 A G 17: 35,684,212 I698T probably damaging Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Fcgbp G T 7: 28,106,196 V1967L probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gtf2h3 A G 5: 124,590,909 N177S probably damaging Het
Mab21l2 C A 3: 86,547,300 R131L probably damaging Het
Maml1 T C 11: 50,257,899 T1005A possibly damaging Het
Mapk4 T C 18: 73,970,325 T38A probably benign Het
Mapkapk5 G A 5: 121,527,178 A338V possibly damaging Het
Morc2a C A 11: 3,681,737 T556K probably damaging Het
Muc16 G A 9: 18,550,843 Q7459* probably null Het
Muc6 T C 7: 141,642,172 T1256A possibly damaging Het
Olfr1271 A G 2: 90,265,578 V284A possibly damaging Het
Olfr1499 T C 19: 13,814,994 I199V probably benign Het
Olfr380 T A 11: 73,453,558 Y218F probably damaging Het
Olfr466 T G 13: 65,152,724 C167G probably damaging Het
Olfr76 A G 19: 12,119,945 C256R probably damaging Het
Olfr835 G T 9: 19,035,478 M118I probably damaging Het
Pik3c2a A G 7: 116,376,229 V701A possibly damaging Het
Plxnb2 A T 15: 89,162,058 I918N probably damaging Het
Pms1 T C 1: 53,267,894 S118G possibly damaging Het
Ppp1r18 A G 17: 35,873,819 T549A probably benign Het
Rap1gds1 T C 3: 138,941,751 I559V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tlx1 A G 19: 45,153,536 T200A possibly damaging Het
Usp1 A G 4: 98,932,868 I488V probably damaging Het
Vmn2r6 T A 3: 64,559,800 M93L probably damaging Het
Zfp870 A T 17: 32,885,992 V31E possibly damaging Het
Other mutations in Krt6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Krt6b APN 15 101679832 missense probably benign 0.22
IGL01653:Krt6b APN 15 101679114 missense probably damaging 1.00
IGL01900:Krt6b APN 15 101677546 missense possibly damaging 0.45
IGL03187:Krt6b APN 15 101679957 missense probably benign
R0511:Krt6b UTSW 15 101677607 splice site probably benign
R0788:Krt6b UTSW 15 101677519 missense probably damaging 0.96
R1370:Krt6b UTSW 15 101677552 missense probably damaging 0.96
R1481:Krt6b UTSW 15 101678374 missense probably benign 0.05
R2007:Krt6b UTSW 15 101678127 missense probably damaging 1.00
R2112:Krt6b UTSW 15 101678564 missense possibly damaging 0.48
R2166:Krt6b UTSW 15 101678615 critical splice acceptor site probably null
R2227:Krt6b UTSW 15 101679122 missense probably damaging 0.96
R2495:Krt6b UTSW 15 101678322 missense probably damaging 1.00
R2496:Krt6b UTSW 15 101679781 missense probably damaging 1.00
R4726:Krt6b UTSW 15 101678085 missense probably damaging 0.98
R4969:Krt6b UTSW 15 101680025 missense possibly damaging 0.71
R6301:Krt6b UTSW 15 101678951 missense probably damaging 1.00
R6646:Krt6b UTSW 15 101677214 missense probably damaging 0.98
R7232:Krt6b UTSW 15 101678142 missense probably damaging 1.00
R7406:Krt6b UTSW 15 101679078 missense probably benign 0.04
R7414:Krt6b UTSW 15 101679014 missense probably benign 0.05
R7849:Krt6b UTSW 15 101678574 missense probably damaging 1.00
R8110:Krt6b UTSW 15 101680142 missense probably damaging 0.96
R8348:Krt6b UTSW 15 101678020 missense probably damaging 1.00
R8448:Krt6b UTSW 15 101678020 missense probably damaging 1.00
Z1177:Krt6b UTSW 15 101678332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCATTCACATCTGTCTCCAC -3'
(R):5'- AAAGCTTGGTCACAGGGATG -3'

Sequencing Primer
(F):5'- ACCACCACGATTTCTCTGGAATGG -3'
(R):5'- CCAAGGAGGGTCCAGGTTTATAG -3'
Posted On 2021-03-08