Incidental Mutation 'R8737:Ttc17'
ID 663073
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Name tetratricopeptide repeat domain 17
Synonyms D2Bwg1005e, 9130020K17Rik
MMRRC Submission 068584-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.556) question?
Stock # R8737 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 94131112-94237034 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 94206374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
AlphaFold E9PVB5
Predicted Effect probably benign
Transcript: ENSMUST00000094801
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111237
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111238
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,308,810 (GRCm39) D375V probably damaging Het
Agfg1 C G 1: 82,871,243 (GRCm39) P492A probably benign Het
Asb13 T C 13: 3,692,089 (GRCm39) V23A probably damaging Het
Atxn1l A T 8: 110,460,230 (GRCm39) C11S probably damaging Het
Bbs9 T G 9: 22,590,244 (GRCm39) S661A probably benign Het
Btrc T C 19: 45,496,198 (GRCm39) V211A probably damaging Het
Camk1g T C 1: 193,030,794 (GRCm39) probably null Het
Capn11 A T 17: 45,943,801 (GRCm39) L578I probably benign Het
Cd82 A T 2: 93,252,239 (GRCm39) I124N probably damaging Het
Cdkl4 G T 17: 80,858,258 (GRCm39) H120Q probably benign Het
Cftr T C 6: 18,319,728 (GRCm39) V1393A probably damaging Het
Col14a1 A T 15: 55,318,706 (GRCm39) R1402* probably null Het
Col6a3 T G 1: 90,727,747 (GRCm39) Y1960S probably benign Het
Col9a1 A T 1: 24,224,127 (GRCm39) Y103F unknown Het
Cux1 A G 5: 136,311,796 (GRCm39) V1180A probably damaging Het
Cyp17a1 A T 19: 46,658,166 (GRCm39) C249S probably benign Het
Derl1 A T 15: 57,755,568 (GRCm39) W42R probably benign Het
Dhx36 C A 3: 62,386,747 (GRCm39) M668I probably benign Het
Dnah6 T C 6: 73,044,428 (GRCm39) K3228E possibly damaging Het
Dst C T 1: 34,267,750 (GRCm39) A3050V probably benign Het
Efr3b A G 12: 4,049,594 (GRCm39) Y70H probably damaging Het
Epb42 T A 2: 120,856,324 (GRCm39) T407S possibly damaging Het
Fads2b T A 2: 85,324,387 (GRCm39) probably benign Het
Fap T A 2: 62,342,777 (GRCm39) I608L probably benign Het
Fblim1 A G 4: 141,310,387 (GRCm39) Y292H probably benign Het
Fmod A G 1: 133,968,043 (GRCm39) I28V probably benign Het
Gad2 T A 2: 22,524,985 (GRCm39) Y256* probably null Het
Gapdh G A 6: 125,139,017 (GRCm39) A353V probably benign Het
Gm5460 T G 14: 33,739,149 (GRCm39) W44G unknown Het
Ino80e A T 7: 126,460,974 (GRCm39) V91D probably benign Het
Iqgap2 G A 13: 95,802,258 (GRCm39) P896S probably damaging Het
Kif26b T A 1: 178,692,430 (GRCm39) I457N probably damaging Het
Klc2 T A 19: 5,168,477 (GRCm39) probably benign Het
Ldlrap1 C A 4: 134,495,147 (GRCm39) W22L probably benign Het
Matn3 A G 12: 9,017,665 (GRCm39) D439G possibly damaging Het
Met T C 6: 17,540,510 (GRCm39) L812P probably benign Het
Mki67 A T 7: 135,315,504 (GRCm39) I90N probably damaging Het
Mptx2 A C 1: 173,105,256 (GRCm39) S12A probably benign Het
Mrgpra9 G T 7: 46,885,624 (GRCm39) N14K probably benign Het
Nbeal2 G A 9: 110,456,949 (GRCm39) R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 (GRCm39) I913T probably benign Het
Nuggc G T 14: 65,882,535 (GRCm39) C760F probably benign Het
Or10a3m T A 7: 108,312,964 (GRCm39) F135I probably damaging Het
Or1j13 T A 2: 36,369,629 (GRCm39) N171I probably benign Het
Or2y1f T A 11: 49,184,965 (GRCm39) F272L probably damaging Het
Or4c110 C A 2: 88,832,351 (GRCm39) E94* probably null Het
Or51b6 A G 7: 103,555,913 (GRCm39) N86S Het
Pdgfrb C T 18: 61,214,073 (GRCm39) P953S probably damaging Het
Pemt T G 11: 59,874,285 (GRCm39) I102L probably benign Het
Pla2g4c G T 7: 13,069,154 (GRCm39) M109I probably benign Het
Pla2g4d T A 2: 120,100,466 (GRCm39) Y622F probably damaging Het
Pmpca T A 2: 26,283,531 (GRCm39) V400D probably damaging Het
Pnpt1 G C 11: 29,104,815 (GRCm39) probably null Het
Pramel29 A C 4: 143,935,192 (GRCm39) L183R probably damaging Het
Prrc1 T A 18: 57,496,408 (GRCm39) S120T possibly damaging Het
Prrx2 T G 2: 30,768,578 (GRCm39) V135G probably damaging Het
Qrfprl A G 6: 65,433,260 (GRCm39) K360R probably benign Het
Recql4 T C 15: 76,593,054 (GRCm39) N352S probably benign Het
Sftpa1 T C 14: 40,856,044 (GRCm39) S130P probably damaging Het
Slc35e2 T C 4: 155,695,042 (GRCm39) L136P probably benign Het
Tarbp2 T A 15: 102,430,202 (GRCm39) S155T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmem116 A T 5: 121,620,433 (GRCm39) Y146F Het
Vmn2r114 G A 17: 23,529,142 (GRCm39) T320I probably benign Het
Vmn2r69 A T 7: 85,055,783 (GRCm39) V785D probably damaging Het
Vmn2r89 T A 14: 51,693,722 (GRCm39) N357K probably damaging Het
Zfp811 A T 17: 33,017,197 (GRCm39) L281Q possibly damaging Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94,153,428 (GRCm39) splice site probably benign
IGL00870:Ttc17 APN 2 94,202,078 (GRCm39) splice site probably null
IGL01120:Ttc17 APN 2 94,202,141 (GRCm39) missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94,163,177 (GRCm39) nonsense probably null
IGL01895:Ttc17 APN 2 94,205,491 (GRCm39) missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94,161,012 (GRCm39) missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94,208,055 (GRCm39) missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94,173,006 (GRCm39) missense probably benign
IGL02456:Ttc17 APN 2 94,193,130 (GRCm39) splice site probably benign
IGL02475:Ttc17 APN 2 94,194,721 (GRCm39) missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94,205,566 (GRCm39) missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94,216,450 (GRCm39) missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94,208,439 (GRCm39) missense probably benign 0.03
R0443:Ttc17 UTSW 2 94,208,439 (GRCm39) missense probably benign 0.03
R0511:Ttc17 UTSW 2 94,153,465 (GRCm39) missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94,163,148 (GRCm39) missense probably benign 0.08
R1980:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R1981:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R1987:Ttc17 UTSW 2 94,194,690 (GRCm39) missense probably benign
R2064:Ttc17 UTSW 2 94,196,892 (GRCm39) missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94,132,139 (GRCm39) missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94,196,987 (GRCm39) missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94,206,419 (GRCm39) nonsense probably null
R3719:Ttc17 UTSW 2 94,194,672 (GRCm39) missense probably benign 0.27
R3852:Ttc17 UTSW 2 94,199,758 (GRCm39) missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94,206,491 (GRCm39) splice site probably benign
R4411:Ttc17 UTSW 2 94,173,098 (GRCm39) missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94,196,916 (GRCm39) missense probably benign 0.02
R4660:Ttc17 UTSW 2 94,194,774 (GRCm39) missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94,202,113 (GRCm39) missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94,163,236 (GRCm39) missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94,194,955 (GRCm39) missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94,196,980 (GRCm39) missense probably benign 0.01
R4870:Ttc17 UTSW 2 94,196,954 (GRCm39) missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94,209,061 (GRCm39) missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94,133,905 (GRCm39) missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94,208,027 (GRCm39) missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94,192,866 (GRCm39) missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94,209,193 (GRCm39) missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94,189,100 (GRCm39) missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94,133,891 (GRCm39) missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94,216,447 (GRCm39) missense probably benign 0.02
R7204:Ttc17 UTSW 2 94,192,773 (GRCm39) missense possibly damaging 0.95
R7300:Ttc17 UTSW 2 94,205,479 (GRCm39) missense probably damaging 1.00
R7446:Ttc17 UTSW 2 94,205,495 (GRCm39) missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94,196,889 (GRCm39) missense probably benign 0.06
R7912:Ttc17 UTSW 2 94,209,166 (GRCm39) missense probably damaging 1.00
R8083:Ttc17 UTSW 2 94,204,909 (GRCm39) missense probably damaging 1.00
R8304:Ttc17 UTSW 2 94,199,526 (GRCm39) intron probably benign
R8381:Ttc17 UTSW 2 94,132,166 (GRCm39) missense probably damaging 1.00
R8512:Ttc17 UTSW 2 94,202,108 (GRCm39) missense probably damaging 1.00
R8850:Ttc17 UTSW 2 94,237,003 (GRCm39) missense possibly damaging 0.55
R8886:Ttc17 UTSW 2 94,205,473 (GRCm39) missense probably benign 0.19
R8888:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R8891:Ttc17 UTSW 2 94,192,764 (GRCm39) missense probably damaging 1.00
R9336:Ttc17 UTSW 2 94,189,198 (GRCm39) missense probably benign 0.00
R9600:Ttc17 UTSW 2 94,204,890 (GRCm39) missense probably damaging 1.00
R9632:Ttc17 UTSW 2 94,209,097 (GRCm39) missense probably damaging 1.00
R9642:Ttc17 UTSW 2 94,194,735 (GRCm39) missense probably benign 0.00
R9657:Ttc17 UTSW 2 94,237,010 (GRCm39) start codon destroyed probably benign 0.02
X0013:Ttc17 UTSW 2 94,161,015 (GRCm39) missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94,209,061 (GRCm39) missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94,154,861 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTTACTGACACCCGTGATCC -3'
(R):5'- ATCTTTGGAGCAGTGCAGTG -3'

Sequencing Primer
(F):5'- GTGATCCTTTCTCTTGACAAGAC -3'
(R):5'- CAGAAGAGCCAGTGTCTTAATTGTGC -3'
Posted On 2021-03-08