Incidental Mutation 'R8737:Pla2g4d'
ID663074
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Namephospholipase A2, group IVD
SynonymsPla2delta, 2610311B01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8737 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120265595-120289197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120269985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 622 (Y622F)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
Predicted Effect probably damaging
Transcript: ENSMUST00000094665
AA Change: Y622F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: Y622F

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,269,729 D375V probably damaging Het
Agfg1 C G 1: 82,893,522 P492A probably benign Het
Asb13 T C 13: 3,642,089 V23A probably damaging Het
Atxn1l A T 8: 109,733,598 C11S probably damaging Het
Bbs9 T G 9: 22,678,948 S661A probably benign Het
Btrc T C 19: 45,507,759 V211A probably damaging Het
C130060K24Rik A G 6: 65,456,276 K360R probably benign Het
C87977 A C 4: 144,208,622 L183R probably damaging Het
Camk1g T C 1: 193,348,486 probably null Het
Capn11 A T 17: 45,632,875 L578I probably benign Het
Cd82 A T 2: 93,421,894 I124N probably damaging Het
Cdkl4 G T 17: 80,550,829 H120Q probably benign Het
Cftr T C 6: 18,319,729 V1393A probably damaging Het
Col14a1 A T 15: 55,455,310 R1402* probably null Het
Col6a3 T G 1: 90,800,025 Y1960S probably benign Het
Col9a1 A T 1: 24,185,046 Y103F unknown Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cyp17a1 A T 19: 46,669,727 C249S probably benign Het
Derl1 A T 15: 57,892,172 W42R probably benign Het
Dhx36 C A 3: 62,479,326 M668I probably benign Het
Dnah6 T C 6: 73,067,445 K3228E possibly damaging Het
Dst C T 1: 34,228,669 A3050V probably benign Het
Efr3b A G 12: 3,999,594 Y70H probably damaging Het
Epb42 T A 2: 121,025,843 T407S possibly damaging Het
Fap T A 2: 62,512,433 I608L probably benign Het
Fblim1 A G 4: 141,583,076 Y292H probably benign Het
Fmod A G 1: 134,040,305 I28V probably benign Het
Gad2 T A 2: 22,634,973 Y256* probably null Het
Gapdh G A 6: 125,162,054 A353V probably benign Het
Gm5460 T G 14: 34,017,192 W44G unknown Het
Ino80e A T 7: 126,861,802 V91D probably benign Het
Iqgap2 G A 13: 95,665,750 P896S probably damaging Het
Kif26b T A 1: 178,864,865 I457N probably damaging Het
Klc2 T A 19: 5,118,449 probably benign Het
Ldlrap1 C A 4: 134,767,836 W22L probably benign Het
Matn3 A G 12: 8,967,665 D439G possibly damaging Het
Met T C 6: 17,540,511 L812P probably benign Het
Mki67 A T 7: 135,713,775 I90N probably damaging Het
Mptx2 A C 1: 173,277,689 S12A probably benign Het
Mrgpra9 G T 7: 47,235,876 N14K probably benign Het
Nbeal2 G A 9: 110,627,881 R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 I913T probably benign Het
Nuggc G T 14: 65,645,086 C760F probably benign Het
Olfr1215 C A 2: 89,002,007 E94* probably null Het
Olfr1392 T A 11: 49,294,138 F272L probably damaging Het
Olfr341 T A 2: 36,479,617 N171I probably benign Het
Olfr512 T A 7: 108,713,757 F135I probably damaging Het
Olfr65 A G 7: 103,906,706 N86S Het
Pdgfrb C T 18: 61,081,001 P953S probably damaging Het
Pemt T G 11: 59,983,459 I102L probably benign Het
Pla2g4c G T 7: 13,335,229 M109I probably benign Het
Pmpca T A 2: 26,393,519 V400D probably damaging Het
Pnpt1 G C 11: 29,154,815 probably null Het
Prrc1 T A 18: 57,363,336 S120T possibly damaging Het
Prrx2 T G 2: 30,878,566 V135G probably damaging Het
Recql4 T C 15: 76,708,854 N352S probably benign Het
Sftpa1 T C 14: 41,134,087 S130P probably damaging Het
Slc35e2 T C 4: 155,610,585 L136P probably benign Het
Tarbp2 T A 15: 102,521,767 S155T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmem116 A T 5: 121,482,370 Y146F Het
Ttc17 C T 2: 94,376,029 probably null Het
Vmn2r114 G A 17: 23,310,168 T320I probably benign Het
Vmn2r69 A T 7: 85,406,575 V785D probably damaging Het
Vmn2r89 T A 14: 51,456,265 N357K probably damaging Het
Zfp811 A T 17: 32,798,223 L281Q possibly damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120289164 start gained probably benign
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120277499 missense probably null 1.00
R8752:Pla2g4d UTSW 2 120268767 critical splice donor site probably null
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCCTTATGTCTGATGTCAC -3'
(R):5'- TGGGCTTCTCATACAAGCAATG -3'

Sequencing Primer
(F):5'- GATGTCACTCTTTGAATTCAGACC -3'
(R):5'- CAATGTCTGTTACTCTTGATGCAGAG -3'
Posted On2021-03-08