Incidental Mutation 'R8737:Pla2g4d'
ID 663074
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8737 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120265595-120289197 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120269985 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 622 (Y622F)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably damaging
Transcript: ENSMUST00000094665
AA Change: Y622F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: Y622F

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,494,043 probably benign Het
Aff3 T A 1: 38,269,729 D375V probably damaging Het
Agfg1 C G 1: 82,893,522 P492A probably benign Het
Asb13 T C 13: 3,642,089 V23A probably damaging Het
Atxn1l A T 8: 109,733,598 C11S probably damaging Het
Bbs9 T G 9: 22,678,948 S661A probably benign Het
Btrc T C 19: 45,507,759 V211A probably damaging Het
C130060K24Rik A G 6: 65,456,276 K360R probably benign Het
C87977 A C 4: 144,208,622 L183R probably damaging Het
Camk1g T C 1: 193,348,486 probably null Het
Capn11 A T 17: 45,632,875 L578I probably benign Het
Cd82 A T 2: 93,421,894 I124N probably damaging Het
Cdkl4 G T 17: 80,550,829 H120Q probably benign Het
Cftr T C 6: 18,319,729 V1393A probably damaging Het
Col14a1 A T 15: 55,455,310 R1402* probably null Het
Col6a3 T G 1: 90,800,025 Y1960S probably benign Het
Col9a1 A T 1: 24,185,046 Y103F unknown Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cyp17a1 A T 19: 46,669,727 C249S probably benign Het
Derl1 A T 15: 57,892,172 W42R probably benign Het
Dhx36 C A 3: 62,479,326 M668I probably benign Het
Dnah6 T C 6: 73,067,445 K3228E possibly damaging Het
Dst C T 1: 34,228,669 A3050V probably benign Het
Efr3b A G 12: 3,999,594 Y70H probably damaging Het
Epb42 T A 2: 121,025,843 T407S possibly damaging Het
Fap T A 2: 62,512,433 I608L probably benign Het
Fblim1 A G 4: 141,583,076 Y292H probably benign Het
Fmod A G 1: 134,040,305 I28V probably benign Het
Gad2 T A 2: 22,634,973 Y256* probably null Het
Gapdh G A 6: 125,162,054 A353V probably benign Het
Gm5460 T G 14: 34,017,192 W44G unknown Het
Ino80e A T 7: 126,861,802 V91D probably benign Het
Iqgap2 G A 13: 95,665,750 P896S probably damaging Het
Kif26b T A 1: 178,864,865 I457N probably damaging Het
Klc2 T A 19: 5,118,449 probably benign Het
Ldlrap1 C A 4: 134,767,836 W22L probably benign Het
Matn3 A G 12: 8,967,665 D439G possibly damaging Het
Met T C 6: 17,540,511 L812P probably benign Het
Mki67 A T 7: 135,713,775 I90N probably damaging Het
Mptx2 A C 1: 173,277,689 S12A probably benign Het
Mrgpra9 G T 7: 47,235,876 N14K probably benign Het
Nbeal2 G A 9: 110,627,881 R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 I913T probably benign Het
Nuggc G T 14: 65,645,086 C760F probably benign Het
Olfr1215 C A 2: 89,002,007 E94* probably null Het
Olfr1392 T A 11: 49,294,138 F272L probably damaging Het
Olfr341 T A 2: 36,479,617 N171I probably benign Het
Olfr512 T A 7: 108,713,757 F135I probably damaging Het
Olfr65 A G 7: 103,906,706 N86S Het
Pdgfrb C T 18: 61,081,001 P953S probably damaging Het
Pemt T G 11: 59,983,459 I102L probably benign Het
Pla2g4c G T 7: 13,335,229 M109I probably benign Het
Pmpca T A 2: 26,393,519 V400D probably damaging Het
Pnpt1 G C 11: 29,154,815 probably null Het
Prrc1 T A 18: 57,363,336 S120T possibly damaging Het
Prrx2 T G 2: 30,878,566 V135G probably damaging Het
Recql4 T C 15: 76,708,854 N352S probably benign Het
Sftpa1 T C 14: 41,134,087 S130P probably damaging Het
Slc35e2 T C 4: 155,610,585 L136P probably benign Het
Tarbp2 T A 15: 102,521,767 S155T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmem116 A T 5: 121,482,370 Y146F Het
Ttc17 C T 2: 94,376,029 probably null Het
Vmn2r114 G A 17: 23,310,168 T320I probably benign Het
Vmn2r69 A T 7: 85,406,575 V785D probably damaging Het
Vmn2r89 T A 14: 51,456,265 N357K probably damaging Het
Zfp811 A T 17: 32,798,223 L281Q possibly damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120289164 start gained probably benign
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120277499 missense probably null 1.00
R8752:Pla2g4d UTSW 2 120268767 critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120269961 missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120269972 missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120268897 missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120277471 missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCCTTATGTCTGATGTCAC -3'
(R):5'- TGGGCTTCTCATACAAGCAATG -3'

Sequencing Primer
(F):5'- GATGTCACTCTTTGAATTCAGACC -3'
(R):5'- CAATGTCTGTTACTCTTGATGCAGAG -3'
Posted On 2021-03-08