Incidental Mutation 'R8737:Pla2g4d'
ID 663074
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission 068584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8737 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120096347-120119678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120100466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 622 (Y622F)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably damaging
Transcript: ENSMUST00000094665
AA Change: Y622F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: Y622F

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,308,810 (GRCm39) D375V probably damaging Het
Agfg1 C G 1: 82,871,243 (GRCm39) P492A probably benign Het
Asb13 T C 13: 3,692,089 (GRCm39) V23A probably damaging Het
Atxn1l A T 8: 110,460,230 (GRCm39) C11S probably damaging Het
Bbs9 T G 9: 22,590,244 (GRCm39) S661A probably benign Het
Btrc T C 19: 45,496,198 (GRCm39) V211A probably damaging Het
Camk1g T C 1: 193,030,794 (GRCm39) probably null Het
Capn11 A T 17: 45,943,801 (GRCm39) L578I probably benign Het
Cd82 A T 2: 93,252,239 (GRCm39) I124N probably damaging Het
Cdkl4 G T 17: 80,858,258 (GRCm39) H120Q probably benign Het
Cftr T C 6: 18,319,728 (GRCm39) V1393A probably damaging Het
Col14a1 A T 15: 55,318,706 (GRCm39) R1402* probably null Het
Col6a3 T G 1: 90,727,747 (GRCm39) Y1960S probably benign Het
Col9a1 A T 1: 24,224,127 (GRCm39) Y103F unknown Het
Cux1 A G 5: 136,311,796 (GRCm39) V1180A probably damaging Het
Cyp17a1 A T 19: 46,658,166 (GRCm39) C249S probably benign Het
Derl1 A T 15: 57,755,568 (GRCm39) W42R probably benign Het
Dhx36 C A 3: 62,386,747 (GRCm39) M668I probably benign Het
Dnah6 T C 6: 73,044,428 (GRCm39) K3228E possibly damaging Het
Dst C T 1: 34,267,750 (GRCm39) A3050V probably benign Het
Efr3b A G 12: 4,049,594 (GRCm39) Y70H probably damaging Het
Epb42 T A 2: 120,856,324 (GRCm39) T407S possibly damaging Het
Fads2b T A 2: 85,324,387 (GRCm39) probably benign Het
Fap T A 2: 62,342,777 (GRCm39) I608L probably benign Het
Fblim1 A G 4: 141,310,387 (GRCm39) Y292H probably benign Het
Fmod A G 1: 133,968,043 (GRCm39) I28V probably benign Het
Gad2 T A 2: 22,524,985 (GRCm39) Y256* probably null Het
Gapdh G A 6: 125,139,017 (GRCm39) A353V probably benign Het
Gm5460 T G 14: 33,739,149 (GRCm39) W44G unknown Het
Ino80e A T 7: 126,460,974 (GRCm39) V91D probably benign Het
Iqgap2 G A 13: 95,802,258 (GRCm39) P896S probably damaging Het
Kif26b T A 1: 178,692,430 (GRCm39) I457N probably damaging Het
Klc2 T A 19: 5,168,477 (GRCm39) probably benign Het
Ldlrap1 C A 4: 134,495,147 (GRCm39) W22L probably benign Het
Matn3 A G 12: 9,017,665 (GRCm39) D439G possibly damaging Het
Met T C 6: 17,540,510 (GRCm39) L812P probably benign Het
Mki67 A T 7: 135,315,504 (GRCm39) I90N probably damaging Het
Mptx2 A C 1: 173,105,256 (GRCm39) S12A probably benign Het
Mrgpra9 G T 7: 46,885,624 (GRCm39) N14K probably benign Het
Nbeal2 G A 9: 110,456,949 (GRCm39) R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 (GRCm39) I913T probably benign Het
Nuggc G T 14: 65,882,535 (GRCm39) C760F probably benign Het
Or10a3m T A 7: 108,312,964 (GRCm39) F135I probably damaging Het
Or1j13 T A 2: 36,369,629 (GRCm39) N171I probably benign Het
Or2y1f T A 11: 49,184,965 (GRCm39) F272L probably damaging Het
Or4c110 C A 2: 88,832,351 (GRCm39) E94* probably null Het
Or51b6 A G 7: 103,555,913 (GRCm39) N86S Het
Pdgfrb C T 18: 61,214,073 (GRCm39) P953S probably damaging Het
Pemt T G 11: 59,874,285 (GRCm39) I102L probably benign Het
Pla2g4c G T 7: 13,069,154 (GRCm39) M109I probably benign Het
Pmpca T A 2: 26,283,531 (GRCm39) V400D probably damaging Het
Pnpt1 G C 11: 29,104,815 (GRCm39) probably null Het
Pramel29 A C 4: 143,935,192 (GRCm39) L183R probably damaging Het
Prrc1 T A 18: 57,496,408 (GRCm39) S120T possibly damaging Het
Prrx2 T G 2: 30,768,578 (GRCm39) V135G probably damaging Het
Qrfprl A G 6: 65,433,260 (GRCm39) K360R probably benign Het
Recql4 T C 15: 76,593,054 (GRCm39) N352S probably benign Het
Sftpa1 T C 14: 40,856,044 (GRCm39) S130P probably damaging Het
Slc35e2 T C 4: 155,695,042 (GRCm39) L136P probably benign Het
Tarbp2 T A 15: 102,430,202 (GRCm39) S155T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmem116 A T 5: 121,620,433 (GRCm39) Y146F Het
Ttc17 C T 2: 94,206,374 (GRCm39) probably null Het
Vmn2r114 G A 17: 23,529,142 (GRCm39) T320I probably benign Het
Vmn2r69 A T 7: 85,055,783 (GRCm39) V785D probably damaging Het
Vmn2r89 T A 14: 51,693,722 (GRCm39) N357K probably damaging Het
Zfp811 A T 17: 33,017,197 (GRCm39) L281Q possibly damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120,112,207 (GRCm39) missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120,097,304 (GRCm39) missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120,111,117 (GRCm39) missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120,105,768 (GRCm39) missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R0962:Pla2g4d UTSW 2 120,111,098 (GRCm39) critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120,099,384 (GRCm39) missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120,114,648 (GRCm39) missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120,100,631 (GRCm39) splice site probably benign
R1680:Pla2g4d UTSW 2 120,108,231 (GRCm39) critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120,107,971 (GRCm39) missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120,101,622 (GRCm39) missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120,112,108 (GRCm39) splice site probably benign
R3122:Pla2g4d UTSW 2 120,109,384 (GRCm39) missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120,114,644 (GRCm39) missense probably benign
R4737:Pla2g4d UTSW 2 120,097,271 (GRCm39) missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120,097,224 (GRCm39) missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120,112,176 (GRCm39) nonsense probably null
R5530:Pla2g4d UTSW 2 120,100,036 (GRCm39) missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120,109,429 (GRCm39) missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120,100,045 (GRCm39) missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120,101,114 (GRCm39) missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120,100,830 (GRCm39) missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120,114,617 (GRCm39) missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120,109,459 (GRCm39) missense probably benign
R7552:Pla2g4d UTSW 2 120,114,620 (GRCm39) missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120,119,457 (GRCm39) missense probably benign
R7692:Pla2g4d UTSW 2 120,109,776 (GRCm39) missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120,097,211 (GRCm39) missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R7972:Pla2g4d UTSW 2 120,109,413 (GRCm39) missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120,107,980 (GRCm39) missense probably null 1.00
R8752:Pla2g4d UTSW 2 120,099,248 (GRCm39) critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120,100,442 (GRCm39) missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120,100,453 (GRCm39) missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120,099,378 (GRCm39) missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120,112,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCCTTATGTCTGATGTCAC -3'
(R):5'- TGGGCTTCTCATACAAGCAATG -3'

Sequencing Primer
(F):5'- GATGTCACTCTTTGAATTCAGACC -3'
(R):5'- CAATGTCTGTTACTCTTGATGCAGAG -3'
Posted On 2021-03-08