Incidental Mutation 'R8737:Dnah6'
ID 663087
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
MMRRC Submission 068584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R8737 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72994589-73198634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73044428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 3228 (K3228E)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000064948
AA Change: K3228E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: K3228E

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114040
AA Change: K3176E

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: K3176E

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204053
AA Change: K3228E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: K3228E

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Meta Mutation Damage Score 0.1547 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,308,810 (GRCm39) D375V probably damaging Het
Agfg1 C G 1: 82,871,243 (GRCm39) P492A probably benign Het
Asb13 T C 13: 3,692,089 (GRCm39) V23A probably damaging Het
Atxn1l A T 8: 110,460,230 (GRCm39) C11S probably damaging Het
Bbs9 T G 9: 22,590,244 (GRCm39) S661A probably benign Het
Btrc T C 19: 45,496,198 (GRCm39) V211A probably damaging Het
Camk1g T C 1: 193,030,794 (GRCm39) probably null Het
Capn11 A T 17: 45,943,801 (GRCm39) L578I probably benign Het
Cd82 A T 2: 93,252,239 (GRCm39) I124N probably damaging Het
Cdkl4 G T 17: 80,858,258 (GRCm39) H120Q probably benign Het
Cftr T C 6: 18,319,728 (GRCm39) V1393A probably damaging Het
Col14a1 A T 15: 55,318,706 (GRCm39) R1402* probably null Het
Col6a3 T G 1: 90,727,747 (GRCm39) Y1960S probably benign Het
Col9a1 A T 1: 24,224,127 (GRCm39) Y103F unknown Het
Cux1 A G 5: 136,311,796 (GRCm39) V1180A probably damaging Het
Cyp17a1 A T 19: 46,658,166 (GRCm39) C249S probably benign Het
Derl1 A T 15: 57,755,568 (GRCm39) W42R probably benign Het
Dhx36 C A 3: 62,386,747 (GRCm39) M668I probably benign Het
Dst C T 1: 34,267,750 (GRCm39) A3050V probably benign Het
Efr3b A G 12: 4,049,594 (GRCm39) Y70H probably damaging Het
Epb42 T A 2: 120,856,324 (GRCm39) T407S possibly damaging Het
Fads2b T A 2: 85,324,387 (GRCm39) probably benign Het
Fap T A 2: 62,342,777 (GRCm39) I608L probably benign Het
Fblim1 A G 4: 141,310,387 (GRCm39) Y292H probably benign Het
Fmod A G 1: 133,968,043 (GRCm39) I28V probably benign Het
Gad2 T A 2: 22,524,985 (GRCm39) Y256* probably null Het
Gapdh G A 6: 125,139,017 (GRCm39) A353V probably benign Het
Gm5460 T G 14: 33,739,149 (GRCm39) W44G unknown Het
Ino80e A T 7: 126,460,974 (GRCm39) V91D probably benign Het
Iqgap2 G A 13: 95,802,258 (GRCm39) P896S probably damaging Het
Kif26b T A 1: 178,692,430 (GRCm39) I457N probably damaging Het
Klc2 T A 19: 5,168,477 (GRCm39) probably benign Het
Ldlrap1 C A 4: 134,495,147 (GRCm39) W22L probably benign Het
Matn3 A G 12: 9,017,665 (GRCm39) D439G possibly damaging Het
Met T C 6: 17,540,510 (GRCm39) L812P probably benign Het
Mki67 A T 7: 135,315,504 (GRCm39) I90N probably damaging Het
Mptx2 A C 1: 173,105,256 (GRCm39) S12A probably benign Het
Mrgpra9 G T 7: 46,885,624 (GRCm39) N14K probably benign Het
Nbeal2 G A 9: 110,456,949 (GRCm39) R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 (GRCm39) I913T probably benign Het
Nuggc G T 14: 65,882,535 (GRCm39) C760F probably benign Het
Or10a3m T A 7: 108,312,964 (GRCm39) F135I probably damaging Het
Or1j13 T A 2: 36,369,629 (GRCm39) N171I probably benign Het
Or2y1f T A 11: 49,184,965 (GRCm39) F272L probably damaging Het
Or4c110 C A 2: 88,832,351 (GRCm39) E94* probably null Het
Or51b6 A G 7: 103,555,913 (GRCm39) N86S Het
Pdgfrb C T 18: 61,214,073 (GRCm39) P953S probably damaging Het
Pemt T G 11: 59,874,285 (GRCm39) I102L probably benign Het
Pla2g4c G T 7: 13,069,154 (GRCm39) M109I probably benign Het
Pla2g4d T A 2: 120,100,466 (GRCm39) Y622F probably damaging Het
Pmpca T A 2: 26,283,531 (GRCm39) V400D probably damaging Het
Pnpt1 G C 11: 29,104,815 (GRCm39) probably null Het
Pramel29 A C 4: 143,935,192 (GRCm39) L183R probably damaging Het
Prrc1 T A 18: 57,496,408 (GRCm39) S120T possibly damaging Het
Prrx2 T G 2: 30,768,578 (GRCm39) V135G probably damaging Het
Qrfprl A G 6: 65,433,260 (GRCm39) K360R probably benign Het
Recql4 T C 15: 76,593,054 (GRCm39) N352S probably benign Het
Sftpa1 T C 14: 40,856,044 (GRCm39) S130P probably damaging Het
Slc35e2 T C 4: 155,695,042 (GRCm39) L136P probably benign Het
Tarbp2 T A 15: 102,430,202 (GRCm39) S155T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmem116 A T 5: 121,620,433 (GRCm39) Y146F Het
Ttc17 C T 2: 94,206,374 (GRCm39) probably null Het
Vmn2r114 G A 17: 23,529,142 (GRCm39) T320I probably benign Het
Vmn2r69 A T 7: 85,055,783 (GRCm39) V785D probably damaging Het
Vmn2r89 T A 14: 51,693,722 (GRCm39) N357K probably damaging Het
Zfp811 A T 17: 33,017,197 (GRCm39) L281Q possibly damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73,172,720 (GRCm39) missense probably benign 0.00
IGL00488:Dnah6 APN 6 73,063,190 (GRCm39) missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73,172,744 (GRCm39) missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73,189,417 (GRCm39) critical splice donor site probably null
IGL00756:Dnah6 APN 6 73,100,754 (GRCm39) missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73,133,333 (GRCm39) missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73,010,509 (GRCm39) splice site probably benign
IGL00972:Dnah6 APN 6 73,060,140 (GRCm39) splice site probably benign
IGL00975:Dnah6 APN 6 73,150,373 (GRCm39) missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73,051,764 (GRCm39) splice site probably benign
IGL01307:Dnah6 APN 6 73,042,708 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73,150,439 (GRCm39) missense probably benign 0.01
IGL01362:Dnah6 APN 6 73,069,161 (GRCm39) missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73,051,731 (GRCm39) missense probably benign 0.10
IGL01559:Dnah6 APN 6 73,001,235 (GRCm39) critical splice donor site probably null
IGL01622:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73,052,785 (GRCm39) missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73,053,643 (GRCm39) nonsense probably null
IGL01736:Dnah6 APN 6 73,165,360 (GRCm39) missense probably benign 0.06
IGL01825:Dnah6 APN 6 73,042,759 (GRCm39) missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73,112,784 (GRCm39) missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73,009,552 (GRCm39) missense probably benign 0.04
IGL01935:Dnah6 APN 6 73,037,126 (GRCm39) missense probably benign
IGL02126:Dnah6 APN 6 73,080,149 (GRCm39) missense probably benign 0.01
IGL02191:Dnah6 APN 6 72,994,780 (GRCm39) missense probably benign 0.00
IGL02293:Dnah6 APN 6 73,110,633 (GRCm39) splice site probably benign
IGL02316:Dnah6 APN 6 73,145,894 (GRCm39) missense probably benign 0.19
IGL02339:Dnah6 APN 6 73,078,881 (GRCm39) missense probably benign 0.00
IGL02380:Dnah6 APN 6 73,053,623 (GRCm39) missense probably benign 0.12
IGL02458:Dnah6 APN 6 73,004,431 (GRCm39) missense probably benign 0.43
IGL02499:Dnah6 APN 6 72,998,210 (GRCm39) missense probably benign 0.12
IGL02652:Dnah6 APN 6 73,072,087 (GRCm39) missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73,098,806 (GRCm39) missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73,185,582 (GRCm39) missense probably benign 0.03
IGL02875:Dnah6 APN 6 73,115,698 (GRCm39) missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73,009,570 (GRCm39) missense probably benign 0.01
IGL02989:Dnah6 APN 6 73,046,403 (GRCm39) missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73,126,123 (GRCm39) missense probably benign 0.19
IGL03135:Dnah6 APN 6 73,121,987 (GRCm39) missense probably benign 0.00
IGL03145:Dnah6 APN 6 73,018,037 (GRCm39) missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73,121,683 (GRCm39) missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73,030,630 (GRCm39) splice site probably benign
IGL03286:Dnah6 APN 6 73,060,068 (GRCm39) missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73,052,833 (GRCm39) missense probably benign 0.15
P0025:Dnah6 UTSW 6 73,140,487 (GRCm39) missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73,042,738 (GRCm39) missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73,185,624 (GRCm39) missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73,078,863 (GRCm39) missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73,091,565 (GRCm39) missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73,037,243 (GRCm39) missense probably benign 0.02
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73,015,717 (GRCm39) splice site probably benign
R0164:Dnah6 UTSW 6 73,165,518 (GRCm39) splice site probably benign
R0165:Dnah6 UTSW 6 72,998,306 (GRCm39) missense probably benign 0.01
R0183:Dnah6 UTSW 6 73,059,906 (GRCm39) missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73,046,403 (GRCm39) missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73,136,098 (GRCm39) missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73,150,541 (GRCm39) missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73,046,382 (GRCm39) splice site probably benign
R0345:Dnah6 UTSW 6 72,998,240 (GRCm39) missense probably benign 0.12
R0357:Dnah6 UTSW 6 73,165,342 (GRCm39) missense probably benign
R0362:Dnah6 UTSW 6 73,185,592 (GRCm39) missense probably benign 0.06
R0377:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73,060,107 (GRCm39) missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73,021,757 (GRCm39) missense probably benign 0.15
R0639:Dnah6 UTSW 6 72,999,395 (GRCm39) missense probably benign 0.02
R0673:Dnah6 UTSW 6 73,100,794 (GRCm39) missense probably benign 0.01
R0690:Dnah6 UTSW 6 73,106,457 (GRCm39) missense probably benign 0.01
R0708:Dnah6 UTSW 6 73,189,605 (GRCm39) missense probably benign 0.05
R0711:Dnah6 UTSW 6 73,064,585 (GRCm39) missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73,012,276 (GRCm39) missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73,101,740 (GRCm39) missense probably benign 0.00
R0972:Dnah6 UTSW 6 73,136,176 (GRCm39) missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73,121,948 (GRCm39) missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73,136,118 (GRCm39) missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73,101,692 (GRCm39) missense probably benign 0.22
R1301:Dnah6 UTSW 6 73,185,528 (GRCm39) critical splice donor site probably null
R1341:Dnah6 UTSW 6 73,168,602 (GRCm39) missense probably benign 0.09
R1509:Dnah6 UTSW 6 73,004,425 (GRCm39) missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73,026,031 (GRCm39) missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73,128,536 (GRCm39) missense probably benign
R1557:Dnah6 UTSW 6 73,026,114 (GRCm39) nonsense probably null
R1591:Dnah6 UTSW 6 73,053,583 (GRCm39) missense probably benign 0.01
R1602:Dnah6 UTSW 6 73,044,452 (GRCm39) missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73,121,946 (GRCm39) missense probably benign 0.09
R1616:Dnah6 UTSW 6 73,077,095 (GRCm39) missense probably benign 0.10
R1643:Dnah6 UTSW 6 73,021,735 (GRCm39) missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73,132,279 (GRCm39) missense probably benign 0.18
R1655:Dnah6 UTSW 6 73,182,715 (GRCm39) missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1665:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1675:Dnah6 UTSW 6 73,106,523 (GRCm39) missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73,021,744 (GRCm39) missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73,137,965 (GRCm39) missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73,001,941 (GRCm39) missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73,158,780 (GRCm39) missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73,077,071 (GRCm39) missense probably benign 0.00
R1897:Dnah6 UTSW 6 73,158,745 (GRCm39) missense probably benign 0.30
R1951:Dnah6 UTSW 6 73,061,704 (GRCm39) nonsense probably null
R1978:Dnah6 UTSW 6 73,098,953 (GRCm39) missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73,072,027 (GRCm39) missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73,069,175 (GRCm39) missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73,044,449 (GRCm39) missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73,150,402 (GRCm39) missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73,004,405 (GRCm39) missense probably benign
R2041:Dnah6 UTSW 6 73,050,422 (GRCm39) missense probably damaging 1.00
R2068:Dnah6 UTSW 6 72,998,165 (GRCm39) missense probably benign 0.23
R2114:Dnah6 UTSW 6 73,121,018 (GRCm39) missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73,026,149 (GRCm39) missense probably benign 0.32
R2163:Dnah6 UTSW 6 73,066,729 (GRCm39) splice site probably null
R2193:Dnah6 UTSW 6 73,115,623 (GRCm39) missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73,077,068 (GRCm39) missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73,090,564 (GRCm39) missense probably benign 0.15
R2292:Dnah6 UTSW 6 72,998,092 (GRCm39) missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73,133,404 (GRCm39) missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73,068,950 (GRCm39) splice site probably null
R2436:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.05
R2847:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R2848:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R3033:Dnah6 UTSW 6 73,150,333 (GRCm39) missense probably benign 0.03
R3429:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73,009,616 (GRCm39) missense probably benign 0.21
R3811:Dnah6 UTSW 6 73,168,481 (GRCm39) missense probably benign 0.00
R3852:Dnah6 UTSW 6 73,104,910 (GRCm39) missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73,066,575 (GRCm39) nonsense probably null
R4246:Dnah6 UTSW 6 73,106,431 (GRCm39) missense probably benign 0.00
R4367:Dnah6 UTSW 6 73,126,467 (GRCm39) missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73,095,009 (GRCm39) missense probably benign 0.01
R4405:Dnah6 UTSW 6 73,106,274 (GRCm39) missense probably benign 0.00
R4420:Dnah6 UTSW 6 73,168,462 (GRCm39) missense probably benign
R4486:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73,155,399 (GRCm39) missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73,169,388 (GRCm39) missense probably benign
R4573:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73,129,695 (GRCm39) missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73,106,643 (GRCm39) missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73,047,580 (GRCm39) missense probably benign
R4653:Dnah6 UTSW 6 73,050,440 (GRCm39) missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73,014,671 (GRCm39) missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73,169,405 (GRCm39) missense probably benign 0.04
R4712:Dnah6 UTSW 6 73,001,995 (GRCm39) critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73,106,513 (GRCm39) missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73,072,057 (GRCm39) missense probably benign 0.11
R4792:Dnah6 UTSW 6 73,066,651 (GRCm39) missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4817:Dnah6 UTSW 6 72,999,407 (GRCm39) missense probably benign 0.02
R4830:Dnah6 UTSW 6 73,021,745 (GRCm39) missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73,098,771 (GRCm39) missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73,169,659 (GRCm39) intron probably benign
R4948:Dnah6 UTSW 6 73,030,672 (GRCm39) missense probably benign 0.00
R4953:Dnah6 UTSW 6 73,165,366 (GRCm39) missense probably benign 0.19
R5000:Dnah6 UTSW 6 73,121,798 (GRCm39) missense probably benign 0.26
R5036:Dnah6 UTSW 6 73,021,674 (GRCm39) missense probably benign
R5044:Dnah6 UTSW 6 73,014,605 (GRCm39) missense probably benign 0.41
R5143:Dnah6 UTSW 6 73,158,744 (GRCm39) missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73,172,617 (GRCm39) missense probably benign
R5186:Dnah6 UTSW 6 73,044,410 (GRCm39) missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73,172,715 (GRCm39) missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73,090,471 (GRCm39) missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73,104,844 (GRCm39) critical splice donor site probably null
R5330:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73,189,603 (GRCm39) missense probably benign
R5343:Dnah6 UTSW 6 73,189,599 (GRCm39) missense probably benign
R5375:Dnah6 UTSW 6 73,100,838 (GRCm39) missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73,014,598 (GRCm39) missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73,037,121 (GRCm39) missense probably benign 0.00
R5455:Dnah6 UTSW 6 73,052,717 (GRCm39) missense probably benign 0.00
R5458:Dnah6 UTSW 6 73,063,168 (GRCm39) missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73,069,140 (GRCm39) missense probably benign 0.04
R5484:Dnah6 UTSW 6 73,069,099 (GRCm39) missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73,167,402 (GRCm39) missense probably null 0.00
R5527:Dnah6 UTSW 6 73,136,212 (GRCm39) missense probably benign
R5541:Dnah6 UTSW 6 73,169,971 (GRCm39) missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73,128,672 (GRCm39) missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73,126,508 (GRCm39) missense probably damaging 1.00
R5689:Dnah6 UTSW 6 72,998,210 (GRCm39) missense probably benign 0.12
R5966:Dnah6 UTSW 6 73,037,262 (GRCm39) missense probably benign 0.00
R5980:Dnah6 UTSW 6 73,158,705 (GRCm39) missense probably benign 0.01
R6049:Dnah6 UTSW 6 73,063,149 (GRCm39) missense probably benign 0.38
R6092:Dnah6 UTSW 6 73,091,680 (GRCm39) missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73,165,477 (GRCm39) missense probably benign 0.16
R6279:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73,063,200 (GRCm39) missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73,168,588 (GRCm39) missense probably benign 0.02
R6394:Dnah6 UTSW 6 73,132,401 (GRCm39) nonsense probably null
R6470:Dnah6 UTSW 6 73,051,569 (GRCm39) missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73,051,687 (GRCm39) missense probably benign 0.05
R6545:Dnah6 UTSW 6 73,021,715 (GRCm39) missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73,150,516 (GRCm39) missense probably benign 0.02
R6609:Dnah6 UTSW 6 73,030,678 (GRCm39) missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73,012,263 (GRCm39) splice site probably null
R6640:Dnah6 UTSW 6 73,001,276 (GRCm39) missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73,115,743 (GRCm39) missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73,014,532 (GRCm39) missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73,110,591 (GRCm39) missense probably benign 0.29
R6845:Dnah6 UTSW 6 73,110,525 (GRCm39) missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73,189,505 (GRCm39) missense probably benign 0.00
R6918:Dnah6 UTSW 6 73,158,738 (GRCm39) nonsense probably null
R6929:Dnah6 UTSW 6 73,021,756 (GRCm39) missense probably damaging 0.96
R6981:Dnah6 UTSW 6 72,998,161 (GRCm39) missense probably benign 0.00
R7065:Dnah6 UTSW 6 73,064,545 (GRCm39) missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73,112,663 (GRCm39) missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73,158,688 (GRCm39) critical splice donor site probably null
R7203:Dnah6 UTSW 6 73,150,528 (GRCm39) missense probably benign 0.00
R7315:Dnah6 UTSW 6 73,061,743 (GRCm39) missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73,121,705 (GRCm39) nonsense probably null
R7387:Dnah6 UTSW 6 73,189,595 (GRCm39) nonsense probably null
R7388:Dnah6 UTSW 6 73,169,300 (GRCm39) missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73,189,475 (GRCm39) missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73,104,887 (GRCm39) missense probably benign 0.04
R7524:Dnah6 UTSW 6 73,095,082 (GRCm39) missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73,004,423 (GRCm39) missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73,126,413 (GRCm39) missense probably benign 0.01
R7604:Dnah6 UTSW 6 73,069,151 (GRCm39) missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73,072,189 (GRCm39) missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73,101,742 (GRCm39) missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73,146,063 (GRCm39) splice site probably null
R7735:Dnah6 UTSW 6 73,046,412 (GRCm39) missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73,002,703 (GRCm39) missense probably benign 0.41
R7829:Dnah6 UTSW 6 73,104,902 (GRCm39) nonsense probably null
R7904:Dnah6 UTSW 6 73,112,450 (GRCm39) splice site probably null
R8034:Dnah6 UTSW 6 73,106,208 (GRCm39) missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73,137,896 (GRCm39) missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73,002,769 (GRCm39) missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73,037,208 (GRCm39) missense probably benign 0.16
R8206:Dnah6 UTSW 6 73,014,549 (GRCm39) nonsense probably null
R8214:Dnah6 UTSW 6 73,021,711 (GRCm39) missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73,145,810 (GRCm39) critical splice donor site probably null
R8273:Dnah6 UTSW 6 73,172,664 (GRCm39) missense probably benign 0.00
R8273:Dnah6 UTSW 6 73,053,582 (GRCm39) missense probably benign 0.31
R8331:Dnah6 UTSW 6 73,001,983 (GRCm39) missense probably benign 0.10
R8350:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8428:Dnah6 UTSW 6 73,051,634 (GRCm39) missense probably benign 0.15
R8447:Dnah6 UTSW 6 73,115,757 (GRCm39) missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8517:Dnah6 UTSW 6 73,155,440 (GRCm39) missense probably benign 0.16
R8523:Dnah6 UTSW 6 73,072,171 (GRCm39) missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73,145,850 (GRCm39) missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73,052,873 (GRCm39) intron probably benign
R8762:Dnah6 UTSW 6 73,156,811 (GRCm39) missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73,042,756 (GRCm39) missense probably benign
R8809:Dnah6 UTSW 6 73,009,546 (GRCm39) missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73,104,937 (GRCm39) missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73,121,156 (GRCm39) critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 72,998,131 (GRCm39) missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73,155,481 (GRCm39) missense probably benign 0.05
R8973:Dnah6 UTSW 6 73,121,734 (GRCm39) missense probably benign 0.39
R9049:Dnah6 UTSW 6 73,119,275 (GRCm39) missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73,061,640 (GRCm39) missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.00
R9077:Dnah6 UTSW 6 73,121,029 (GRCm39) nonsense probably null
R9102:Dnah6 UTSW 6 73,044,469 (GRCm39) missense probably benign
R9106:Dnah6 UTSW 6 73,121,752 (GRCm39) missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73,037,186 (GRCm39) missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73,098,882 (GRCm39) missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73,121,924 (GRCm39) missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73,121,688 (GRCm39) nonsense probably null
R9200:Dnah6 UTSW 6 73,004,497 (GRCm39) missense probably benign 0.06
R9265:Dnah6 UTSW 6 73,060,040 (GRCm39) missense probably benign 0.02
R9368:Dnah6 UTSW 6 72,998,261 (GRCm39) missense probably benign 0.22
R9378:Dnah6 UTSW 6 73,189,513 (GRCm39) missense probably benign
R9439:Dnah6 UTSW 6 73,012,330 (GRCm39) missense possibly damaging 0.66
R9506:Dnah6 UTSW 6 73,119,299 (GRCm39) missense probably damaging 1.00
R9645:Dnah6 UTSW 6 73,115,750 (GRCm39) missense possibly damaging 0.82
R9731:Dnah6 UTSW 6 73,168,589 (GRCm39) missense probably benign 0.00
RF002:Dnah6 UTSW 6 73,078,872 (GRCm39) missense probably benign
RF020:Dnah6 UTSW 6 73,095,040 (GRCm39) missense probably benign 0.00
W0251:Dnah6 UTSW 6 73,155,501 (GRCm39) missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73,168,483 (GRCm39) missense probably benign 0.01
X0025:Dnah6 UTSW 6 73,014,656 (GRCm39) missense probably damaging 1.00
Z1176:Dnah6 UTSW 6 73,110,542 (GRCm39) missense probably benign
Z1176:Dnah6 UTSW 6 73,064,766 (GRCm39) missense possibly damaging 0.79
Z1177:Dnah6 UTSW 6 73,009,509 (GRCm39) missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 72,998,220 (GRCm39) missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73,132,255 (GRCm39) missense possibly damaging 0.92
Z1177:Dnah6 UTSW 6 73,018,121 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGATCCTGAAGCTATGAC -3'
(R):5'- TATAGTCACGCACAGGGCAG -3'

Sequencing Primer
(F):5'- TGGCTCTTCTGGAACAACAG -3'
(R):5'- CACAGGGCAGGACACAGC -3'
Posted On 2021-03-08